ID: 1124255177

View in Genome Browser
Species Human (GRCh38)
Location 15:28135306-28135328
Sequence AGTTTTATGTTCCAATACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124255177 Original CRISPR AGTTTTATGTTCCAATACGA AGG (reversed) Intronic
903584710 1:24403574-24403596 AGTATTATGTTCCATTAATATGG + Intronic
905275116 1:36812547-36812569 ATTTTTATCTTCCAAGACGGAGG + Intronic
908695520 1:66836438-66836460 AGTTTTTTGTTCCCATAAGAAGG - Intronic
917283419 1:173400543-173400565 AGTTTTAATTTCCAATTCAATGG - Intergenic
919951355 1:202366928-202366950 AGTTTTATGTACCAAAACTATGG + Intronic
1068138800 10:52978008-52978030 TGGCTTATGTTCCAATACCAGGG - Intergenic
1068861033 10:61848435-61848457 AATTTTATTTTCCAAAAAGATGG - Intergenic
1074004699 10:109409060-109409082 AGTATTATGTTGCAATAAAAAGG + Intergenic
1074167041 10:110889955-110889977 AGTTTAATATTCTAATAAGATGG + Intronic
1074626627 10:115196419-115196441 AATTTTATATTGCAATATGAAGG - Intronic
1078974534 11:16457271-16457293 ATTTTTATGATCCAGTACTAAGG - Intronic
1080240491 11:30121901-30121923 TGTTTCATGTTCCAAAAAGATGG + Intergenic
1086099711 11:83086285-83086307 TGTTTTATTCTCCAATACTATGG - Intergenic
1090756714 11:129798162-129798184 AGTTTTGTGTTCAACTACCAGGG - Intergenic
1093416495 12:18926621-18926643 AGTTTTATCTTCAAATTAGAAGG - Intergenic
1097446154 12:59674713-59674735 AGATCTATGTTCCAATAAAAAGG + Intronic
1098346618 12:69511644-69511666 AGTTCTATGATCCATTACAAAGG + Intronic
1100104467 12:91152079-91152101 AATATTATGTTCCAATATTATGG - Intronic
1101381101 12:104214812-104214834 AGATTTCTGTTCAAATAGGATGG + Intergenic
1109316275 13:60753544-60753566 AGTTTTAAATTCTAATAGGAAGG - Intergenic
1115476201 14:33815296-33815318 AGTTTTGGGTTCCATTACCAAGG - Intergenic
1117804544 14:59477629-59477651 AGTTTTCTGTTCCATTAAGCAGG - Intronic
1124107152 15:26749969-26749991 AGTTTTGTGTTCCAGGAGGAAGG + Intronic
1124255177 15:28135306-28135328 AGTTTTATGTTCCAATACGAAGG - Intronic
1132005468 15:98222575-98222597 AGTTTTATGTTTCAAAATGTTGG + Intergenic
1137597196 16:49732393-49732415 ACTTTTATTTTCCAATCCGAGGG - Intronic
1153498712 18:5725893-5725915 ACTTTTATGTTACGATATGAAGG + Intergenic
1156369210 18:36457485-36457507 TGTTTTACATTCAAATACGAAGG + Intronic
1156742499 18:40349273-40349295 AGTTTCATGTTTCAAAACCAGGG - Intergenic
1159207331 18:65270295-65270317 AATTTTATGTTTCAATAAGTTGG + Intergenic
1166209245 19:41295319-41295341 ATATTTATGTTCAAATACAAAGG - Intronic
925696612 2:6586700-6586722 AGTTTTATGTCTGAATAAGAAGG + Intergenic
930833676 2:55772852-55772874 AGGTTTATGTAACAATGCGAAGG + Intergenic
931070408 2:58641636-58641658 TGTTTTATTTTGCAATAAGAAGG + Intergenic
931802155 2:65768987-65769009 AGTTTTAAGTTTAAATACCACGG - Intergenic
939200203 2:139024110-139024132 AGTTTCATCTTCCAATTCAATGG - Intergenic
939214986 2:139225222-139225244 TGTTTTATTTTACAATAAGAGGG - Intergenic
939954551 2:148516074-148516096 AGTGTTACGTTCAAATAAGAAGG - Intronic
943449590 2:188031430-188031452 AGTATTATGTACCAATAAAAGGG + Intergenic
1169707043 20:8517603-8517625 AGTTTTAGGTTACAATATGAAGG - Intronic
1170182777 20:13551620-13551642 AGTTTGTTTTCCCAATACGAGGG + Intronic
1177051138 21:16235488-16235510 AGTTTTATATTAGAATACCATGG + Intergenic
1181880363 22:25974709-25974731 AGTTTTATGTTCCAAAACAGGGG - Intronic
950328893 3:12140046-12140068 AGTTTTGTGTTCAAATGCAATGG + Intronic
955646641 3:61145640-61145662 AGTTTTCTGATCCAATAACATGG + Intronic
960372372 3:116856279-116856301 ATTTTCATTTTACAATACGAAGG - Intronic
963590798 3:147256066-147256088 ATTTTTATGTTCAAGTAAGAAGG + Intergenic
965531064 3:169769867-169769889 AGTTTTATTTTCCAAAGCCACGG + Exonic
966392076 3:179463607-179463629 AGTTTTAGGATCCAACACGTGGG - Intergenic
967699251 3:192572227-192572249 AGTTTTATGTTCCTGGAGGATGG - Intronic
971685546 4:29761595-29761617 AGTTTGATGTTTAAATATGATGG - Intergenic
971770844 4:30895018-30895040 AGTTTTATCTTCTTATACCAAGG + Intronic
972765184 4:42146279-42146301 AGCTTTATCTTCCACTAGGAGGG - Intronic
975183399 4:71373181-71373203 AGTTATATGGTCCAATCAGAGGG + Intronic
975730278 4:77331014-77331036 AGTTTTATTTTCCCAAACAAAGG + Intronic
978957887 4:114637152-114637174 AGTTTTATGGTCCACTCCTACGG + Intronic
979140409 4:117165193-117165215 AATTTTATGTACCAATTTGAAGG - Intergenic
979296760 4:119041763-119041785 AGCTATATGTTACACTACGAAGG - Intronic
979595491 4:122529979-122530001 AGTTTTAACTTCCAATTCAATGG + Intergenic
980746155 4:137019527-137019549 AGTTTTAAGTTCCAGTTCAAGGG + Intergenic
989826090 5:45857556-45857578 AGTTTTATTTTTCAATATGGTGG + Intergenic
991356679 5:65775941-65775963 AATTTTATGTTACAGTACTAAGG - Intronic
993252517 5:85547908-85547930 AGTGCTGTGTTCCATTACGATGG - Intergenic
993968229 5:94384614-94384636 AGGTTTTTATTCCAATAAGACGG + Intronic
997007172 5:129831955-129831977 ATTTTTATATTCAAATACAAGGG + Intergenic
998775261 5:145592897-145592919 AGGTATATATTCCAATAGGAAGG - Intronic
1006092825 6:31637898-31637920 AATTTAAAGATCCAATACGATGG - Intergenic
1012395276 6:98789289-98789311 GGTTTTATGTTCCATTAGAAAGG + Intergenic
1012828506 6:104178225-104178247 TGTTTTCTGTTCCAATGCCATGG + Intergenic
1018693204 6:166366447-166366469 AGTTTTATGTTCAAATATCAGGG + Intronic
1020797571 7:12695335-12695357 ATTTTTAAGTTCCAAAACAATGG - Intergenic
1020956640 7:14746805-14746827 AGTTTTCTGTACCAATAAAAAGG - Intronic
1021072599 7:16260275-16260297 AGATTTATTTTCCAGTAAGATGG + Intronic
1022082922 7:27041790-27041812 AGAGTTATGTCCCAATACTAGGG + Intergenic
1030217916 7:107065588-107065610 AGTTGTATTTTCAAATACAATGG - Intronic
1034955762 7:155333552-155333574 AGTTTAGTGTTCCAATATGTGGG - Intergenic
1035442979 7:158919336-158919358 CGTTTTATGTTCCATAACCACGG - Intronic
1037131715 8:15414464-15414486 AGATTTTTGTTCCAAGAAGAGGG - Intergenic
1038221863 8:25616220-25616242 AGATTTATGGTCCAATCAGAGGG + Intergenic
1039014914 8:33136612-33136634 AGCTTTATATTACAATACCACGG + Intergenic
1044782663 8:95759224-95759246 AGTTTTATGTCCCCCTAAGAAGG - Intergenic
1055183926 9:73427197-73427219 AGTTTTTTGTTACTATACAATGG + Intergenic
1059952610 9:119482276-119482298 ACTGTTATCTTCCCATACGATGG - Intergenic
1186094943 X:6090513-6090535 AGTTTTATGCTGCTATATGAAGG + Intronic
1189670265 X:43400792-43400814 AGTTTTTTTTTCCAAGAGGAGGG - Intergenic
1192817559 X:74610481-74610503 ATTTTAATGTTCCAACACAAGGG - Intronic
1199058221 X:143322903-143322925 AGTTTAATTTTCCAATAATATGG - Intergenic