ID: 1124256258

View in Genome Browser
Species Human (GRCh38)
Location 15:28145189-28145211
Sequence CCAGGTGACCAGGCAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 1, 2: 1, 3: 47, 4: 385}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124256248_1124256258 24 Left 1124256248 15:28145142-28145164 CCAGGCCAGGGGCCATGGGGACA 0: 1
1: 0
2: 2
3: 58
4: 382
Right 1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG 0: 1
1: 1
2: 1
3: 47
4: 385
1124256249_1124256258 19 Left 1124256249 15:28145147-28145169 CCAGGGGCCATGGGGACATTTCC 0: 1
1: 0
2: 1
3: 19
4: 194
Right 1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG 0: 1
1: 1
2: 1
3: 47
4: 385
1124256252_1124256258 12 Left 1124256252 15:28145154-28145176 CCATGGGGACATTTCCCGGGAAA 0: 1
1: 0
2: 0
3: 3
4: 117
Right 1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG 0: 1
1: 1
2: 1
3: 47
4: 385
1124256254_1124256258 -3 Left 1124256254 15:28145169-28145191 CCGGGAAAGCTCTGATACAACCA 0: 1
1: 1
2: 1
3: 11
4: 135
Right 1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG 0: 1
1: 1
2: 1
3: 47
4: 385
1124256253_1124256258 -2 Left 1124256253 15:28145168-28145190 CCCGGGAAAGCTCTGATACAACC 0: 1
1: 1
2: 2
3: 9
4: 93
Right 1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG 0: 1
1: 1
2: 1
3: 47
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124256258 Original CRISPR CCAGGTGACCAGGCAGCAGA AGG Intronic
900392807 1:2441063-2441085 CCAGGTGCCCAGGAAGTGGAGGG + Intronic
900950022 1:5853327-5853349 CCAGGGGAGGAGTCAGCAGAGGG + Intergenic
901324268 1:8357582-8357604 CCATCTCACCAGGCTGCAGAGGG + Intronic
901716486 1:11159102-11159124 TCAGGTGATCTGCCAGCAGATGG - Intronic
901799865 1:11701759-11701781 CCAGGCAACCAGGCAGAAGGAGG - Intronic
902143128 1:14373602-14373624 CCAGATGTCCAGGCAGCCCATGG + Intergenic
903177491 1:21589764-21589786 CCAGCTGACCAGGCTGTGGATGG - Intergenic
904011571 1:27393101-27393123 CCAGGTGTCCGGGCAGAAGGAGG + Intronic
905025384 1:34846095-34846117 CCATGTAAACAGGCAGCAAAAGG + Intronic
905205944 1:36342905-36342927 CTTGGGCACCAGGCAGCAGAGGG - Intronic
905915069 1:41678904-41678926 CCAGATGTCCAGGGAGAAGAAGG + Intronic
905921141 1:41719708-41719730 CACGGTGACCAGGCTCCAGAAGG + Intronic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
906568018 1:46814210-46814232 CCAGGTCATCAGGGAGCGGAAGG + Exonic
907515296 1:54989869-54989891 GGAGGTGAGCAGGCAGGAGATGG + Intronic
907783589 1:57590168-57590190 CCACGTGAAGAGGCAGCAAAAGG - Intronic
908939005 1:69409901-69409923 CCAGGTGTGCTGGCTGCAGAGGG - Intergenic
908942492 1:69452569-69452591 CCAGGTCTACAGGCATCAGAGGG - Intergenic
910310902 1:85823561-85823583 CCAGGTGACCAGGGTGAACAAGG - Exonic
915296216 1:154923627-154923649 CCAGGTGCCCAGGAACCTGAAGG - Intergenic
918341747 1:183573471-183573493 CCATGTGGCCTCGCAGCAGAAGG - Intronic
918521524 1:185420281-185420303 CCAAGTGACCCGGCAGCTGCGGG - Intergenic
922470042 1:225870896-225870918 CAAGGTGACCAGGCAGCCCCTGG - Intronic
922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG + Intergenic
923262283 1:232278867-232278889 CAAGGTGCCTAGGCAGCAAATGG + Intergenic
1062907539 10:1188978-1189000 CCAGGTGCCCAGGCTCCAGGAGG + Intronic
1062923856 10:1299736-1299758 CCAGGAGGTCAGGAAGCAGAAGG - Intronic
1064197302 10:13255411-13255433 CCAGGGGATCCAGCAGCAGAAGG - Intergenic
1064338943 10:14469458-14469480 GCAGGTGTCCAGGCAGCAACAGG + Intergenic
1064692264 10:17930399-17930421 CCAGCTGGCCAGTCAACAGAGGG - Intergenic
1065294164 10:24258911-24258933 CCAGGTCAACAGGCAGCTGTGGG - Intronic
1066553278 10:36583030-36583052 ACAGGTGACCAGCCAGTATATGG + Intergenic
1070618499 10:77988035-77988057 CCAGGAGCCCAGGCAGCCAAGGG + Intronic
1071471069 10:85984384-85984406 CCAGGTGGCCAGGTGGTAGATGG - Intronic
1071678939 10:87684983-87685005 CCAGGTCACCAGGCTACACAGGG + Intronic
1072197812 10:93131610-93131632 CAAGCTGACCAGGCCACAGAAGG - Intergenic
1072685475 10:97534027-97534049 CAAGGTTTCCAGGCAGTAGAAGG - Intronic
1073043782 10:100624328-100624350 CCAGGACAGCAGGCAGCAGAGGG - Intergenic
1073069285 10:100783044-100783066 ACAGGAGCCCATGCAGCAGAGGG - Intronic
1073686922 10:105765093-105765115 CCAGGTGACCATGCTGTGGAGGG + Intergenic
1074122016 10:110499642-110499664 ACAGGGGACCAGTCAGCAGGAGG - Intronic
1074326879 10:112459014-112459036 CCAGCTGACCAGCCTTCAGAAGG - Intronic
1075651491 10:124130449-124130471 CCAGGCTCCCAGACAGCAGATGG - Intergenic
1075991497 10:126842516-126842538 CCAGGGGGCCAGCCAGAAGAGGG + Intergenic
1076290611 10:129342739-129342761 GCAGCTGAACAGGCAGCACAAGG + Intergenic
1076862260 10:133143766-133143788 CCAGGTGCCGAGGCAAGAGACGG + Intergenic
1077111716 11:864993-865015 TCAGGGGACCCAGCAGCAGACGG - Intronic
1077282925 11:1753720-1753742 CCAGGTGAGCGGGCAACAGGTGG - Intronic
1077374060 11:2197419-2197441 CCAGGTGGCCGGGCTGCAGGAGG + Intergenic
1077548725 11:3189556-3189578 CCTGGGGACCAGCCAGCAGCTGG - Intergenic
1078522851 11:12077278-12077300 CAAGGTTCCCAGGCTGCAGAAGG - Intergenic
1081614664 11:44583527-44583549 TCAGGGGATCAGGCAGCAGGCGG + Intronic
1081667967 11:44927479-44927501 CCAGGTGCCCAGGCTGCTGGAGG - Intronic
1081801272 11:45860941-45860963 CTTGGTGACCAGCCAGCAGATGG + Exonic
1081858803 11:46320400-46320422 CCAGGTGATCATGCTGCAGGTGG - Exonic
1082559033 11:54597290-54597312 CAAGGTGATCAGGCAGGAGAAGG - Intergenic
1082969726 11:59006735-59006757 CAAGGTGCCAAGGCAGTAGAAGG + Intronic
1083860740 11:65418679-65418701 CCAGGTCAGGAGGCAGGAGAGGG - Intergenic
1084188720 11:67489210-67489232 CCCGGTGACCAGCCAGCCCACGG + Intronic
1084486034 11:69448887-69448909 CTAGGGGACCAGGCAGCATGGGG + Intergenic
1084942984 11:72623854-72623876 GCAGCTGCCCAGGCAGGAGATGG - Intronic
1085315339 11:75541473-75541495 GCTGGAGCCCAGGCAGCAGATGG - Intergenic
1085528157 11:77175933-77175955 CCAGCTGCCCAGGCAGCAATGGG - Intronic
1085866457 11:80300395-80300417 ACATGTGACAGGGCAGCAGATGG + Intergenic
1086961258 11:92981873-92981895 CCAGATGCGCAGGTAGCAGAAGG - Exonic
1087095926 11:94317943-94317965 CCAGGCAATCAGGCAGGAGAAGG + Intergenic
1087397897 11:97625758-97625780 ACAGGACACCAGGCATCAGAAGG - Intergenic
1089156694 11:116408125-116408147 CCAGGTCACCAGCTTGCAGAAGG + Intergenic
1089395810 11:118135900-118135922 CCAGCTGAGCAGGAAGCAGCTGG + Exonic
1089572525 11:119419912-119419934 CCAGTTGACCAGGCAGCAGTTGG + Intronic
1089609877 11:119663248-119663270 CCAGGGGATCTGGGAGCAGATGG + Exonic
1089647691 11:119890901-119890923 CCAGGAGACCAAGAAGCAGGTGG + Intergenic
1090583029 11:128180821-128180843 CCAGGTGAACACTCAACAGAGGG - Intergenic
1091448322 12:557580-557602 CCAGGGGGTCAGGCAGGAGAAGG - Intronic
1092288748 12:7145882-7145904 CCAGGTGAGCTGGCAACTGATGG - Intronic
1094063028 12:26334718-26334740 CCAGTTGACCAGGCAAAGGAAGG + Intergenic
1096231618 12:49900061-49900083 CCAGGTGGCCAGGCCACAGAGGG + Intronic
1097932138 12:65200004-65200026 CCAGGTAACAAGGGAACAGAGGG + Intronic
1100393593 12:94165220-94165242 CCAGGGAGCCAGGCAGAAGAAGG - Intronic
1100554001 12:95673810-95673832 CCATGAAACAAGGCAGCAGAGGG - Intronic
1101356687 12:103985644-103985666 CCAGGTTATGAGGCAGCATATGG + Exonic
1101791779 12:107934147-107934169 CCTGGTGACCACGCAGAACAAGG - Intergenic
1103331939 12:120160198-120160220 GCAGCTGACCAGCAAGCAGAAGG - Exonic
1103981931 12:124742350-124742372 CAAGGTGAACAGGCAGCCGCAGG + Intergenic
1105068971 12:133222399-133222421 CCGGGTACCCAGGCAGCAGCAGG + Intronic
1105587576 13:21759140-21759162 CCAGGTGACCAGACATCACCTGG + Intergenic
1106110316 13:26771431-26771453 CCAGGTGACCAGGAAGGGCAGGG - Intergenic
1106174827 13:27321195-27321217 GCAGGTGACCGGGAAGGAGAAGG + Intergenic
1106235075 13:27854388-27854410 CCAGGTAACCAGCGACCAGATGG + Intergenic
1110809284 13:79793474-79793496 CCAGGTAAACAGGAAGGAGAAGG + Intergenic
1111770218 13:92586754-92586776 CCAAGTGCCCTGGGAGCAGAGGG + Intronic
1111848590 13:93543018-93543040 CACGGTGATCAGGCAGCAGAAGG - Intronic
1113609713 13:111635464-111635486 CCAGGATCCCAGGCAGCACAAGG + Intronic
1117776218 14:59188014-59188036 CAAGGTGACCAGGCAGAACGCGG - Intergenic
1117898646 14:60511359-60511381 CCAGGTGACCAGGGACCCGCGGG + Exonic
1118793223 14:69115234-69115256 CCAGGTGCCTACGCAACAGAAGG + Intronic
1120258656 14:82153968-82153990 CCAGTTGACCAGGAGACAGAAGG + Intergenic
1121047049 14:90795965-90795987 ACAGGGAACCAGGCAGGAGAGGG + Intronic
1121493635 14:94377585-94377607 CCATGTGACTAGGGAGGAGAAGG + Exonic
1121648368 14:95536158-95536180 CCAGGGCACCAGGGACCAGATGG + Intronic
1121803773 14:96797146-96797168 CTAGAAGACCAGGGAGCAGAAGG + Intergenic
1122199244 14:100112302-100112324 CCAGGTGTCCATGCAGCAGGGGG + Intronic
1122249419 14:100427572-100427594 GCAGGTGTCCAGGCAGGAGCCGG + Intronic
1122295524 14:100703640-100703662 CCAGGAGACAAGGCTGCAGATGG - Intergenic
1122327388 14:100890809-100890831 ACAGCAGGCCAGGCAGCAGAGGG - Intergenic
1122329881 14:100904871-100904893 CCAGGCGCCCAGGAAGCCGAGGG + Intergenic
1122603443 14:102932500-102932522 CCAGGTGCCCATCCAGCAGAAGG + Exonic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1123460238 15:20463769-20463791 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1123657824 15:22536648-22536670 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG + Intronic
1124266459 15:28239498-28239520 CCTGCTAACCAGACAGCAGAGGG + Intronic
1124311733 15:28631846-28631868 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1124336337 15:28860085-28860107 CCAGGCCTCCAGGCTGCAGATGG + Intergenic
1124567990 15:30833952-30833974 CCAGGTGGCCAGGCAGCAGAAGG - Intergenic
1124593612 15:31075964-31075986 CCAGATGCCCAGGCAATAGAGGG - Intronic
1125678760 15:41517423-41517445 GCAGGAGACCAAGGAGCAGAAGG - Exonic
1125826222 15:42678699-42678721 GCAGGTGTCTAGGCAGCAGCTGG + Intronic
1127143126 15:55997045-55997067 CCAGGTTACAAGGCAGAGGAAGG + Intergenic
1127178896 15:56393234-56393256 CCAGGTGAGTAGGGAGTAGAGGG - Intronic
1127854731 15:62945149-62945171 CAAGGTGACCAGCCAGGACATGG + Intergenic
1128775826 15:70319566-70319588 CCAGGAGAGCAGGGTGCAGAGGG + Intergenic
1128822811 15:70675877-70675899 CCAGGTGAGGATGCAGCAAAAGG + Intronic
1129316732 15:74749794-74749816 CCAGAATACCAGGCAGAAGATGG - Exonic
1129659248 15:77543716-77543738 GCAGGAGACCAGCCAGGAGAGGG + Intergenic
1131091839 15:89629417-89629439 CCAGCTGACCCTGCAGCAGAAGG - Exonic
1131108521 15:89750394-89750416 CCAGGTGGCCAGGCTGCCGGCGG + Intronic
1131367467 15:91853163-91853185 CCGGGTGCCCAGGCCTCAGAGGG - Intergenic
1131666082 15:94572442-94572464 CCAATTGCCCAGGCAGAAGAAGG + Intergenic
1132367172 15:101266088-101266110 GCCTGTGACCAGGCAGCAGGAGG + Intergenic
1132466063 16:77948-77970 CCAGGCGACCAGGGCGCAGGCGG + Intronic
1132525943 16:414816-414838 CCAGGTTCCCTGGCACCAGAGGG - Intergenic
1132599351 16:767102-767124 CCAGTTACCCTGGCAGCAGACGG - Intronic
1132859103 16:2061315-2061337 ACAGGAGGCCAGGCAGCAGAAGG + Intronic
1132872107 16:2119858-2119880 CCAGGCTACCAGGGAGCACAGGG + Intronic
1133038823 16:3049163-3049185 CCCTGAGACCAGGCAGAAGACGG + Intronic
1133126853 16:3652746-3652768 CCAGCTGGCCATGAAGCAGAAGG - Intronic
1134180926 16:12047060-12047082 CCAGGTCACCAGGTAGCAAGGGG - Intronic
1134211845 16:12284187-12284209 CCAAGTCACCAGGCTGCAGAAGG - Intronic
1134274328 16:12762173-12762195 CCAGGGGACTAAGCAGAAGAGGG - Intronic
1134520418 16:14917038-14917060 CCAGGCTACCAGGGAGCACAGGG - Intronic
1134551157 16:15138936-15138958 CCAGGCTACCAGGGAGCACAGGG + Intronic
1134715305 16:16355722-16355744 CCAGGCTACCAGGGAGCACAGGG - Intergenic
1134716874 16:16361729-16361751 CCAGGTGAGAACACAGCAGAGGG - Intergenic
1134957877 16:18390430-18390452 CCAGGTGAGAACACAGCAGAGGG + Intergenic
1134959452 16:18396437-18396459 CCAGGCTACCAGGGAGCACAGGG + Intergenic
1135069448 16:19339290-19339312 CCAGTTGACCAAGCAAGAGAGGG - Intergenic
1135687168 16:24507160-24507182 CCATGTGAAAAGGCAGCAGGAGG - Intergenic
1136704653 16:32176944-32176966 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1136763260 16:32752462-32752484 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1136804840 16:33117924-33117946 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1137290437 16:47048863-47048885 ACAGGAGGCCAGGCAGCAGCAGG + Intergenic
1137619654 16:49868039-49868061 CTAACTGACCAGGCAGGAGAAGG + Intergenic
1138134678 16:54511511-54511533 CCTGGAGACAAGGTAGCAGAGGG + Intergenic
1139636487 16:68261312-68261334 CCTGCTGACCAGGCAGGAGCAGG - Intergenic
1141196577 16:81865626-81865648 CCAGGAGCCCAGACAGCAGCAGG - Intronic
1142174999 16:88641041-88641063 CCAGGGGGCCAGGCAGGGGAGGG - Intergenic
1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG + Intronic
1142263445 16:89053034-89053056 CCAGGGGACCTGGCAGGGGAAGG - Intergenic
1203065411 16_KI270728v1_random:1012784-1012806 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1142600504 17:1051399-1051421 CCAGGTAACAAGGCAGTGGAGGG + Intronic
1143181519 17:4987042-4987064 CCAGGTGTCCAGGATGGAGATGG + Exonic
1143305592 17:5944124-5944146 CCAGGAGACCAGGCAGAAGGAGG - Intronic
1144512396 17:15888287-15888309 GCTGGTGACCAAGGAGCAGATGG - Intergenic
1144726548 17:17505272-17505294 CCAAGGGAAGAGGCAGCAGAGGG + Intergenic
1145248253 17:21283898-21283920 CCCGGTGACGAGGCAGCACGAGG - Intergenic
1145250698 17:21295512-21295534 CCAGATGGCCAGGCAGCCCAGGG - Intronic
1145289762 17:21533951-21533973 CCCGGTGTCCAGGCTACAGAGGG - Exonic
1145809621 17:27756614-27756636 CCAGGTGTGCCAGCAGCAGATGG - Intergenic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1147190248 17:38734235-38734257 CCAGGTGACCGGGCCTCAGCTGG + Exonic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1148346510 17:46907166-46907188 CGAGGTCAACAGACAGCAGAGGG + Intergenic
1149217890 17:54379535-54379557 CCAGGAGAAGAGGCAACAGATGG - Intergenic
1149868106 17:60161728-60161750 CCTGGTGACCACGCAGCTGTGGG + Intronic
1150226704 17:63528346-63528368 CCCTGGGCCCAGGCAGCAGATGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151155019 17:72118107-72118129 GCAGGTCACGAGGCAGGAGACGG - Intergenic
1151477788 17:74353591-74353613 TGAGGTGGCCGGGCAGCAGAGGG - Intronic
1151765465 17:76131286-76131308 CCAGGGGACCAGGGAGGAGGAGG - Intergenic
1151918782 17:77138748-77138770 CCAGGTGATGATGCTGCAGACGG + Intronic
1157471850 18:47994955-47994977 CCAGGTCAGCAGGCAAAAGAAGG - Intergenic
1157609958 18:48950028-48950050 CCAGGCGGCCGGGCAGCAGGAGG + Exonic
1158244460 18:55415447-55415469 CTATGTGAGCAGCCAGCAGAGGG + Intronic
1158397565 18:57091119-57091141 CCTAGTGAACAGTCAGCAGAAGG + Intergenic
1158810829 18:61032124-61032146 CCAGGTGCCCAAGCAGGAGATGG + Intergenic
1159914714 18:74178375-74178397 TAAGCTGACCAGGAAGCAGAGGG + Intergenic
1159945666 18:74442813-74442835 CCAAGTGATAAGGCAGTAGAGGG - Intronic
1160251178 18:77204674-77204696 GCAGGTGTCCAGGCTACAGATGG - Intergenic
1160504763 18:79420804-79420826 CCAGGTGACGTCGCTGCAGAGGG + Intronic
1160720774 19:596049-596071 CCAGGTCTCCTGGCAACAGAAGG - Intronic
1161271177 19:3390175-3390197 CCAGGTGTCTGGACAGCAGAGGG + Intronic
1161554613 19:4933615-4933637 CTGGGTGACCAGGCAGAGGAGGG - Intronic
1162506410 19:11088433-11088455 CTAGGAGACCAGGCAGAAAAGGG - Intergenic
1162540196 19:11291000-11291022 CCAGCTGCCCAGACAACAGAGGG + Intergenic
1164802242 19:31087305-31087327 CCAGGTGAGCAGGGAAGAGAGGG - Intergenic
1164941198 19:32253251-32253273 CCTGGTGACCAGGGAAGAGAAGG - Intergenic
1165050652 19:33139366-33139388 CCATGAGGCCAGGCTGCAGAAGG + Intronic
1167118017 19:47499362-47499384 CCAGTTTCCCAGGGAGCAGAAGG + Intronic
1167301142 19:48678449-48678471 CCAGGTCACCAGCCTGCAGAAGG + Intergenic
925429450 2:3778480-3778502 TCTGCTGACCAGGGAGCAGAGGG + Intronic
925913308 2:8587295-8587317 GGAGGTGACCAGGGAGCCGAGGG - Intergenic
926128215 2:10284786-10284808 CCAGGTATGCAGGCAGCAGGTGG - Intergenic
927001092 2:18794600-18794622 TCAGGTTCCCAGGCAGCAGGTGG + Intergenic
927089625 2:19700650-19700672 CCAGGCCACCACCCAGCAGAAGG + Intergenic
927859500 2:26551530-26551552 ACAGGTGCCCAGGCAGCTCATGG - Intronic
927967489 2:27280449-27280471 CCAGGGGACTGGGCAGCAGAAGG - Exonic
927972803 2:27316378-27316400 CCAAGTGACAGGGCAGCAGTAGG + Intronic
928124382 2:28605719-28605741 CCAGGTCACCAGCCACCACAGGG - Intronic
929220715 2:39462323-39462345 CCAGAAGAACAGGGAGCAGAAGG + Intergenic
929490532 2:42392270-42392292 CCAGGTGACCTGGCAGGGCAGGG - Intronic
929589088 2:43133611-43133633 CCAGGTGACCTGGAAGCAGCTGG + Intergenic
931246081 2:60493893-60493915 AGAGGTGAACAGGAAGCAGAAGG + Intronic
933405264 2:81850211-81850233 CCAAGTGGAAAGGCAGCAGAAGG + Intergenic
933483314 2:82884577-82884599 CCAGGTGACAATTCAGAAGAAGG + Intergenic
933774667 2:85764920-85764942 CCAGGTCACCAGGCAGATGAAGG + Intronic
934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG + Intergenic
934574414 2:95391162-95391184 CTCGGTGGCCAGGCAGCAGTCGG - Intergenic
935262782 2:101369421-101369443 CGAGGTGCCCAGGAAGCAGGTGG + Intronic
935668829 2:105538029-105538051 CCAGGTAGCCCTGCAGCAGAGGG - Intergenic
935725647 2:106021674-106021696 CCAGGAGGCCACGCTGCAGAAGG + Intergenic
936343518 2:111657950-111657972 CCAGGTGAGGATGAAGCAGAAGG + Intergenic
937144198 2:119628145-119628167 CCATTTGCCCAGGCAGCAGAAGG - Intronic
937588237 2:123582607-123582629 AGAGGTGACCAGGGAGCAGGTGG - Intergenic
939740232 2:145897502-145897524 CCACGTGAAGAGGCAGCAAATGG - Intergenic
939995899 2:148919319-148919341 CCAGGTGTCTATGCAGCACATGG - Intronic
940259619 2:151766334-151766356 CCACATGACCAGGGAGCAGTGGG + Intergenic
940347215 2:152640170-152640192 CCAAGTGTCCAGGCACCAGAAGG - Intronic
941037455 2:160584023-160584045 CCAGGTGACCACACAGCCCATGG - Intergenic
941440787 2:165532707-165532729 CAGGGTGATCAGGCAGGAGAAGG + Intronic
941638941 2:167966983-167967005 CCAGGTGCACAGTCAGGAGATGG - Intronic
941821015 2:169843309-169843331 CCATGTGAAGATGCAGCAGAAGG - Intronic
946995272 2:225384094-225384116 CCATGTCCCCAGGCTGCAGAGGG - Intergenic
947274732 2:228377718-228377740 CCAGGAAACCAGGCTGCAGAAGG + Intergenic
947526798 2:230882028-230882050 CCAGATGAACATACAGCAGAGGG - Intergenic
947527290 2:230886455-230886477 GCATGTGACCTGGCAGCACAGGG + Intergenic
947854368 2:233313233-233313255 CCAGGTGAAAGTGCAGCAGAAGG + Intronic
948062605 2:235052678-235052700 CAAGGTCTCCAAGCAGCAGATGG + Exonic
948410849 2:237759370-237759392 CCTGGAGGCCAAGCAGCAGATGG - Intronic
948423100 2:237872479-237872501 CCAGGAGCCCCGGCTGCAGATGG - Intronic
948519883 2:238529328-238529350 CCAGGTGTCCAGGCTGAACAGGG - Intergenic
948596652 2:239083725-239083747 CCAGGTGCCCACACAGCAGCAGG + Intronic
1168775049 20:440344-440366 CCAGGTGATGAGCCAGCTGAGGG + Exonic
1168837217 20:885279-885301 CCTGGAGACCAAGCAGCAGGAGG - Exonic
1168889277 20:1283735-1283757 CCAGGAGTCCAGGTATCAGAAGG - Intronic
1170994138 20:21335850-21335872 TCAGCTGACCTGGCAGGAGAGGG + Intronic
1171393806 20:24818008-24818030 CCAGGGGAGCAGGCAGCTCAGGG - Intergenic
1173197967 20:40931590-40931612 GCAGCTGCACAGGCAGCAGATGG + Intergenic
1173323607 20:42011958-42011980 CAAGCTGACCAGGAAGGAGAGGG - Intergenic
1173454928 20:43194291-43194313 CTGAGGGACCAGGCAGCAGATGG - Intergenic
1173846222 20:46190408-46190430 ACAAATGACCAGGCAGCAGGAGG - Intronic
1174296404 20:49548387-49548409 CCAGGAGAGAAGGCGGCAGATGG + Intronic
1174340051 20:49889946-49889968 CCTGGTGACGAGGGGGCAGACGG - Exonic
1174582117 20:51579445-51579467 CCAGGTGACCCGCCAGCTGCCGG - Intergenic
1174917524 20:54669131-54669153 CCAGCTGCCCAAGCAGCAAATGG + Intergenic
1175216896 20:57395927-57395949 CCAGGAGCCCAGGCAGCTGAGGG + Intronic
1175772006 20:61629875-61629897 CCAGCTGAACAGGAGGCAGAGGG + Intronic
1175830000 20:61958895-61958917 CCAGGTGGCCATCCAGGAGAAGG - Intronic
1175863508 20:62162759-62162781 CCACGTGTCCATGCAGCAGACGG + Exonic
1178007404 21:28237090-28237112 CCAGGTAACCAGGAAGGAGGAGG + Intergenic
1178029366 21:28506484-28506506 CCAGGTGACAAGGTATGAGATGG - Intergenic
1178849337 21:36200253-36200275 CCAGGTGACAAGCCAGCCGAGGG - Intronic
1179077986 21:38142152-38142174 CCACGTCTCCAGGCAGCAGGAGG + Intronic
1179784190 21:43720274-43720296 CCCAGTGACCAGGCCGCAGGTGG - Intronic
1179800996 21:43811431-43811453 CCAGCTGCCCAGGCCCCAGAGGG + Intergenic
1180172116 21:46064999-46065021 CCAGGTGACCGGCCAGCAGCAGG + Intergenic
1180911529 22:19454241-19454263 ACAGGACACCAGGGAGCAGAGGG + Intronic
1180959022 22:19754390-19754412 CCCTGGGACCAGGGAGCAGATGG + Intergenic
1181040916 22:20192283-20192305 CCTGGTGACCAGCCTTCAGATGG + Intergenic
1181106949 22:20581281-20581303 CCACCCCACCAGGCAGCAGAGGG - Intronic
1181181346 22:21070644-21070666 CCAGGTTACCATGGAGCAGTGGG - Intergenic
1181442735 22:22945031-22945053 CCAGGTGACCAGGAAGGAGGAGG + Intergenic
1182436644 22:30335082-30335104 CCATGTGACCTGGCATCAGGCGG + Intronic
1182506905 22:30790057-30790079 CAAGGTGACTGGGCTGCAGAAGG + Intronic
1182713963 22:32340519-32340541 GCACGTGACAAGGCAGCTGAAGG + Intergenic
1183686677 22:39365040-39365062 CCAGGTCACCAGCAAGCAGAGGG - Intronic
1184493380 22:44823469-44823491 CCATGTGATCAGGCAGAAGTTGG + Intronic
1184665570 22:45987205-45987227 CCAAGAGCCCAGGGAGCAGAAGG + Intergenic
1184893637 22:47394363-47394385 CCAGGTGTCATGGCAGCAGGTGG - Intergenic
1185078615 22:48696640-48696662 GCAGGTGTCCAGGCAGCTGATGG + Intronic
950291792 3:11790704-11790726 CTAGGAGACCAGGGAGCTGAAGG + Intronic
950494254 3:13324280-13324302 CCAGGAGTGCAGGCAGGAGAGGG - Intronic
950522465 3:13505216-13505238 CCTGGTTCCCAGGCAGCAGGTGG + Exonic
951079723 3:18438807-18438829 CCAGGTGTGCAGGAAGTAGAGGG - Intronic
953024898 3:39139155-39139177 CCTGGAGACCAGACAGGAGAGGG - Intergenic
953295451 3:41711028-41711050 CCATGGGAGCAGGCAGCTGATGG + Intronic
953387283 3:42513754-42513776 CCAGGCGGCCAGGCTGCAGGAGG + Exonic
954004304 3:47579139-47579161 CCAGGTGAACAGGCGGCACGGGG + Exonic
954363048 3:50132626-50132648 CCAGGCTTCCAGGCTGCAGATGG + Intergenic
954388675 3:50257833-50257855 CCAGGGGACAAGGGAGGAGAAGG + Intronic
954982344 3:54757828-54757850 CCAGATTACCAGCCAGCAGGCGG + Intronic
955977174 3:64490186-64490208 GTAGGGGACCTGGCAGCAGATGG - Intergenic
956836141 3:73097471-73097493 TCAGCTGGGCAGGCAGCAGAGGG + Intergenic
959003538 3:100992845-100992867 CCTGTTGACCAGGAAGCTGAGGG - Intronic
960265810 3:115619659-115619681 CCATGTGCAGAGGCAGCAGAGGG + Intergenic
960377486 3:116921444-116921466 CAAGGTTACCAAGAAGCAGATGG + Intronic
961010607 3:123433268-123433290 TCAGCTGAGCAGGCTGCAGAGGG - Intronic
961378404 3:126481991-126482013 GCAGGTGGCCAGGAAGCAGAGGG + Exonic
961451961 3:127006277-127006299 TCATGTGGCCAGGCAGCAGATGG + Intronic
961648204 3:128403877-128403899 CCAGATCTCCAGACAGCAGAAGG - Intronic
961755847 3:129126986-129127008 CCAGCTGACTAGCAAGCAGAGGG - Intronic
962864820 3:139439478-139439500 CCAGCTGGGCAGGCAGCTGATGG + Intergenic
964228554 3:154435575-154435597 CCAGGCAATCAGGCAGGAGAAGG - Intergenic
964304719 3:155327584-155327606 GCAGGGGACCAGGGAGCAGGAGG - Intergenic
965006470 3:163032648-163032670 GCAGGTGACCATGCAGCTTAAGG - Intergenic
965535833 3:169822814-169822836 CAAGTTGACCAGGCACCTGAAGG - Exonic
967804451 3:193702749-193702771 ACAGGTAACCAGGTAGTAGAAGG - Intergenic
967946486 3:194807994-194808016 GCAGGAGACCCGGGAGCAGAAGG + Intergenic
968048204 3:195635552-195635574 CCAGGAGACCGGGCAGCGGACGG - Intergenic
968099200 3:195954068-195954090 CCAGGAGACCGGGCAGCGGACGG + Intergenic
968306407 3:197654369-197654391 CCAGGAGACCGGGCAGCGGACGG + Intergenic
968978937 4:3836383-3836405 CCAGGTGACCCGACAGCGGTGGG + Intergenic
969260603 4:6030921-6030943 CCAGGTGATGAGGACGCAGACGG + Intronic
969296263 4:6271974-6271996 CCAGAAGAGGAGGCAGCAGAGGG - Intronic
969478182 4:7432961-7432983 CCAGATGTCCATCCAGCAGAAGG + Exonic
969671633 4:8593141-8593163 CCGGGACCCCAGGCAGCAGAGGG + Intronic
970447586 4:16136954-16136976 CCAGGGCTCCTGGCAGCAGATGG - Intergenic
970677138 4:18463880-18463902 CCAGGGGACCATGTAGGAGATGG + Intergenic
971303801 4:25463275-25463297 CCTGGTGGCCAGGCAGCAGGTGG - Intergenic
971347390 4:25823757-25823779 CCAGGAGCCCAGGGAGCCGAAGG + Intronic
975600585 4:76095782-76095804 CCTGGGGACCAGGCACCAGGGGG - Intronic
979831743 4:125314233-125314255 CCAGGTGACTAGGGGGCAGGAGG - Intergenic
981626875 4:146767236-146767258 CCAGTGAACCAGGCAGAAGATGG - Intronic
984800821 4:183715462-183715484 CCAGGTGAGGAGGCTTCAGAAGG - Intergenic
985260043 4:188106596-188106618 CCAGGTGACCGGCCAGGAGACGG + Intronic
985504696 5:272045-272067 CCAGGAGACCGGGCAGCGGACGG - Intronic
985559276 5:574269-574291 CCAGGTGGGAAGGGAGCAGAGGG + Intergenic
985636636 5:1038897-1038919 GCAGGAGGCCAAGCAGCAGAAGG + Exonic
985743417 5:1633550-1633572 CCAGGAGACCGGGCAGCGGACGG + Intergenic
985952958 5:3237313-3237335 CCATGGAAGCAGGCAGCAGAAGG + Intergenic
985985279 5:3510633-3510655 CCGGGAGACCAGGCAGGAGGAGG + Intergenic
986202757 5:5592812-5592834 CCACATAACCAGGCAGCGGAAGG - Intergenic
986298852 5:6462392-6462414 CCAGAAGCCCAGGCAACAGAGGG + Intronic
986569293 5:9148687-9148709 CCAGGTGACAGTGCAGCAGGAGG - Intronic
990056092 5:51580679-51580701 ACAAGAGACCAGGCAGCAAATGG + Intergenic
990442502 5:55860928-55860950 CCATGTGAAGAGGCAGCAAAAGG - Intronic
995202644 5:109443611-109443633 CCAGGGCATCAGGCAGGAGAAGG - Intergenic
997299662 5:132793356-132793378 CATGGAGACCCGGCAGCAGAAGG + Intronic
997900402 5:137758296-137758318 CTAGGTGATCATGCAGCAGCTGG + Intergenic
998393672 5:141804492-141804514 CCTCCTGACCAGTCAGCAGAGGG + Intergenic
998562064 5:143180970-143180992 CCAGGTTTCCATGCACCAGATGG - Intronic
999262671 5:150247343-150247365 CTACATGACAAGGCAGCAGAGGG - Intronic
999723684 5:154417605-154417627 CCAGGTGAGGAGTCAGAAGAGGG + Exonic
1000697625 5:164407544-164407566 CCATGTGAAGAGGCAGCAGTAGG + Intergenic
1001546099 5:172571225-172571247 CCAGTTTAACAGGAAGCAGAGGG + Intergenic
1002071378 5:176680531-176680553 ACTGGGGACCCGGCAGCAGAGGG + Intergenic
1003439252 6:6124023-6124045 CTGGGTTTCCAGGCAGCAGACGG + Intergenic
1003617664 6:7670198-7670220 CCAGGTGACCAGGATTCAAAAGG + Intergenic
1003624823 6:7731148-7731170 CCAGCAGCCCAGGCAGCAGACGG - Intronic
1003669064 6:8139123-8139145 CAAAGTGACCAGGAAGGAGAGGG - Intergenic
1005458330 6:26043336-26043358 CCAGCTCCCCAGGCAGCAGCAGG + Exonic
1005480639 6:26251950-26251972 CCAGTTCCCCAGGCAGCAGCAGG - Exonic
1006316068 6:33292526-33292548 CCAGGTGACAAGCCAGGACAAGG - Exonic
1006994639 6:38247434-38247456 GCTGAAGACCAGGCAGCAGATGG + Intronic
1007119122 6:39365893-39365915 CTTGGTGAACAGACAGCAGAAGG + Intronic
1007329903 6:41098122-41098144 CCAGATGACCAGTCAACAGAGGG - Exonic
1007372028 6:41432374-41432396 CCAAGTGCCCAGGCAGGAGTCGG + Intergenic
1007385601 6:41518295-41518317 GCAGGTGGGGAGGCAGCAGAAGG - Intergenic
1007629243 6:43263584-43263606 CCAAGTGACAAGGCAGGAGAAGG + Intronic
1007692957 6:43714736-43714758 GGAGGTGGGCAGGCAGCAGAGGG - Intergenic
1007732369 6:43954879-43954901 CCAGAAGCCCAGGCTGCAGAGGG - Intergenic
1008774120 6:55014891-55014913 TGAGGTGACAAGACAGCAGATGG + Intergenic
1010544104 6:77128540-77128562 CCAGGTTATCAGGCAAGAGAGGG + Intergenic
1011342777 6:86335948-86335970 CCAGGAGTCCAGGAAGCTGAAGG + Intergenic
1012132895 6:95519157-95519179 CCAGCTCACCAAGCTGCAGATGG - Intergenic
1013517674 6:110903311-110903333 CGAGGAGACAAGGCAGCCGAAGG - Intergenic
1016692240 6:146951124-146951146 CCAGGGGAGCAGGCAGCTGCAGG - Intergenic
1016840438 6:148519694-148519716 CCAGGTGTCCAGGCTGCTGGAGG - Exonic
1017211507 6:151862363-151862385 CTAGGTTAACAGGCAACAGATGG + Intronic
1017704475 6:157109134-157109156 CCATGTGGCCAGGCAGGACACGG - Intronic
1018826167 6:167409298-167409320 CCTGGTGACAGGGCAGCCGAGGG - Intergenic
1019186782 6:170225090-170225112 CCAGGTGCTCAGGCAGGACACGG + Intergenic
1019733207 7:2638547-2638569 CCAGGTCGCCAGGCTGCACATGG - Intronic
1022479707 7:30734745-30734767 CCAGGAGTTGAGGCAGCAGAGGG - Intronic
1027202813 7:76073827-76073849 CCAGGCCACCAGGGAGCCGAAGG + Intergenic
1030243850 7:107359904-107359926 CAAGGTGACCTGCCTGCAGAAGG + Intronic
1030328933 7:108252219-108252241 CCAGCTGACCACGCAGGAGCAGG - Intronic
1032792595 7:135253422-135253444 CCAGCTGACCTGGAAGGAGAAGG + Intronic
1033659465 7:143393652-143393674 CCAGGTAACCATGCAGGGGAAGG - Exonic
1034392812 7:150800042-150800064 CCAGGCGTGCAGGCGGCAGAAGG + Intronic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1034699392 7:153083349-153083371 CCAGGTGGCCATTCAGCAGCTGG + Intergenic
1034717041 7:153253012-153253034 CCAGGTCTCCAGCCTGCAGAGGG + Intergenic
1034718953 7:153270277-153270299 CAGGGTGATCAGGCAGGAGAAGG + Intergenic
1034889320 7:154825939-154825961 CTAGGTGAGAAGGTAGCAGATGG + Intronic
1035594391 8:843617-843639 CCAGGTGACCAGACAGCCCAGGG - Intergenic
1035608801 8:947319-947341 GCAGGGGTCCTGGCAGCAGAGGG + Intergenic
1035749391 8:1985177-1985199 GCAGGTGACCCGGCAGGAGAAGG + Intronic
1036989099 8:13571377-13571399 CGAGGTGACCAGGTACCAGGGGG - Intergenic
1037085132 8:14838921-14838943 AAAGGTGACCAGGAAGCAGGTGG + Intronic
1037632295 8:20669193-20669215 GCAGGTGTCCAGGCAGGTGAGGG - Intergenic
1037983803 8:23273891-23273913 CCAAGTGAAGAGGCAGCAAATGG + Intronic
1038646955 8:29369952-29369974 GCAAGTGACCAGGCAGAGGAGGG + Intergenic
1038662317 8:29507736-29507758 CCAGGTGACCAGGTACCTTAGGG - Intergenic
1040972747 8:53154788-53154810 CGATGTGAACAGGCAGAAGATGG + Intergenic
1041109234 8:54469781-54469803 CCAGGTAAGCAGGCAACGGAGGG - Intergenic
1043342262 8:79254532-79254554 CAAGGTGACCAGGCATCACCTGG + Intergenic
1045349169 8:101322588-101322610 ACAGATGACCAGGGAGCAGATGG + Intergenic
1046553278 8:115743938-115743960 CAAGATGACCAGGCAAGAGAAGG + Intronic
1049735125 8:144200799-144200821 CCAGGTGACCATGCCTCTGAGGG + Intronic
1049826378 8:144671512-144671534 CCAGGTGAGCAGGCATCTGGGGG - Intergenic
1051455986 9:17258968-17258990 CCAGGCAATCAGGCAGCAGAAGG - Intronic
1052356651 9:27511900-27511922 TCAGGTGCCCAGGAAGGAGAGGG - Intronic
1052503662 9:29325244-29325266 CTAGGCGTCCAGCCAGCAGATGG + Intergenic
1053000524 9:34574975-34574997 CCAGGTCACCAGGCAGCATGCGG - Intronic
1053169710 9:35869768-35869790 CCAGGGGTACAGGCAGCAGCAGG + Exonic
1053238839 9:36479515-36479537 CCAGAAGACCAGGGAGCAGAAGG + Intronic
1055710546 9:79056303-79056325 GCAGGGAAGCAGGCAGCAGACGG + Intergenic
1056687316 9:88777345-88777367 ACAGGTGACCACGCAGAAGGAGG - Intergenic
1057169825 9:92955042-92955064 TCAGGTGGCCAAGGAGCAGAGGG + Intronic
1059615517 9:115946711-115946733 CCAGGTGACCAGGAAGGGGGAGG + Intergenic
1060136333 9:121158851-121158873 ACAGGTGACAAGTCAGCAGCAGG + Exonic
1060440674 9:123636253-123636275 CCAGGTGACCAGGAACACGACGG + Intronic
1060840583 9:126790248-126790270 CCAGGAGAAAATGCAGCAGAAGG + Intergenic
1061401984 9:130373493-130373515 CATGGTGACAAGGCAGCAGCTGG - Intronic
1061596703 9:131635174-131635196 CTAGGTGACCAGGAGGCAGTGGG - Intronic
1061836900 9:133335556-133335578 CCTGGTGACCACGCTGCACAAGG - Intronic
1061974693 9:134062251-134062273 CCAGGCGGCCAGGCAGCTGCAGG - Intronic
1062128949 9:134882363-134882385 CCAGGTGACCCTCCAGCTGAGGG + Intronic
1062188429 9:135231067-135231089 CCCAGAGAGCAGGCAGCAGACGG + Intergenic
1062272499 9:135716157-135716179 CCAGCTGAACAGGCATCTGAGGG - Intronic
1062285592 9:135771221-135771243 ACAGGAGACCAGGCAGGACAGGG + Intronic
1062338206 9:136081805-136081827 CCAGGTAACCAGGCAACACCAGG + Intronic
1062571223 9:137186277-137186299 CCAGGTGACCCGGGAGAGGATGG - Exonic
1203794518 EBV:169514-169536 GCGGGTGACGAAGCAGCAGACGG + Intergenic
1186078923 X:5909206-5909228 ACCGGTGACCAGGCAGCAAAAGG - Exonic
1187581286 X:20610115-20610137 GCAGGTGGTCAGGCAGCAGGAGG + Intergenic
1196349145 X:114704704-114704726 CCAGGCAATCAGGCAGGAGAAGG + Intronic
1197272675 X:124442734-124442756 CCAGGGGACAAGGCTGCAGTGGG - Intronic
1198096339 X:133383555-133383577 CCATGTGTCCAGGCAACAGTAGG - Intronic
1198236295 X:134738598-134738620 CCGGGTGACCAGACAGCTCATGG + Intronic
1199618439 X:149677703-149677725 CCAGGTGATGGGGCAGAAGAAGG + Intergenic
1199624203 X:149725546-149725568 CCAGGTGATGGGGCAGAAGAAGG - Intergenic
1199993276 X:153002145-153002167 CCAGGGTTCCAGGCAGGAGATGG - Intergenic
1201516508 Y:14824199-14824221 ACCGGTGACCAGGCAGCAAAAGG + Exonic