ID: 1124258421

View in Genome Browser
Species Human (GRCh38)
Location 15:28164841-28164863
Sequence TTGGCAGTCTCCTGGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124258421_1124258425 -2 Left 1124258421 15:28164841-28164863 CCCTCAAACCAGGAGACTGCCAA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1124258425 15:28164862-28164884 AAAAATTAGAAGTTGATTCCAGG 0: 1
1: 0
2: 1
3: 30
4: 374
1124258421_1124258427 19 Left 1124258421 15:28164841-28164863 CCCTCAAACCAGGAGACTGCCAA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1124258427 15:28164883-28164905 GGCACCTAATTCATAAATAGAGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124258421 Original CRISPR TTGGCAGTCTCCTGGTTTGA GGG (reversed) Intronic
901474043 1:9476898-9476920 GAGGCAGTCACCTGGATTGAAGG - Intergenic
901812497 1:11775912-11775934 TTGGGAAGCTCCTGGTGTGATGG + Intronic
902786490 1:18735762-18735784 CAGGCTGTCTCCTGGCTTGATGG - Exonic
905445546 1:38026436-38026458 TTGACACTCTCCTGCTTTGGTGG - Intergenic
906198362 1:43943899-43943921 TTTGTAGTCCCCTGGTTTGAGGG - Intergenic
906814267 1:48862066-48862088 AAGGCAGTCTCCTGGTGGGAAGG - Intronic
908224214 1:62039921-62039943 GAGGCAGTCTCCTGGTTGGGGGG + Intronic
908851824 1:68384610-68384632 TTGGGAGTCTCCAGGCTTAAAGG + Intergenic
909440251 1:75688756-75688778 TTGCCTGGCTTCTGGTTTGAGGG - Intergenic
913333173 1:117684073-117684095 TTCAGAGTCTCCTTGTTTGAAGG + Intergenic
914249020 1:145906814-145906836 TTGGTAGTCACCTGGTTGGAAGG + Exonic
914392757 1:147236949-147236971 GAGGCAGTCTCCTGGGTGGAAGG - Intronic
914435280 1:147654091-147654113 GTGGAGGCCTCCTGGTTTGAAGG - Intronic
917313605 1:173702666-173702688 CTGGCAGTCTGCTGGCTTGCTGG + Intergenic
919919865 1:202161407-202161429 ATGGGAGTCCCCTGGTGTGAGGG - Exonic
920234421 1:204493611-204493633 TTGGCAGGCTTCTGGATTGTGGG - Intronic
920565598 1:206970205-206970227 TTCTCAGTCTCCAGGTTTAAAGG - Exonic
1067029543 10:42871122-42871144 TGGGCAGGCTCCTGGTGTGGAGG + Intergenic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1078336252 11:10465715-10465737 GAGGCAGTCTCCTGGTCTGCAGG - Intronic
1078637888 11:13068875-13068897 TTGGAAGTCCCCAGGCTTGAGGG - Intergenic
1078732962 11:13992701-13992723 GAGGAAGTCTCCTGGTTTGTGGG + Intronic
1080134291 11:28836333-28836355 TTGCCAGTCTCATGCTGTGATGG + Intergenic
1083630831 11:64094533-64094555 ATGGCAGGCTCCTGGAGTGAAGG + Intronic
1085781487 11:79413059-79413081 TTTGCAGTAGCCTGATTTGATGG - Intronic
1089422115 11:118339801-118339823 TTGGGAGTCTTCTGCTTTGCTGG - Exonic
1089796029 11:120981856-120981878 TTGCCAGTGTCCTTGATTGATGG + Intronic
1090205128 11:124879695-124879717 TTGGCAGCCTCCTGGTGCCAGGG + Intronic
1092215136 12:6676400-6676422 TTTGTAGTCTCCTGGGTGGATGG + Intronic
1096590925 12:52658865-52658887 TTGGCAGTAATCTGGTTTCATGG - Intergenic
1102988893 12:117300621-117300643 TGGGGGGTCTGCTGGTTTGAGGG + Intronic
1106153267 13:27126579-27126601 AATGCAGCCTCCTGGTTTGAAGG - Intronic
1108756388 13:53508118-53508140 TTGGAAGTCTCAAGGTTTGCAGG - Intergenic
1113579558 13:111419375-111419397 TTTGCAATCACCTGTTTTGAAGG - Intergenic
1113763742 13:112867863-112867885 TTGGGAGTATCCTGGTTGGAAGG - Intronic
1116093559 14:40338617-40338639 TTCACTGTCTCCTGGTTTCAAGG - Intergenic
1121563991 14:94895046-94895068 ATGGCAGTTTCTTGGTCTGATGG + Intergenic
1124258421 15:28164841-28164863 TTGGCAGTCTCCTGGTTTGAGGG - Intronic
1126412496 15:48386595-48386617 TTGGCAGTCACCTGGTAGGCTGG - Intergenic
1130709721 15:86267916-86267938 TGCTCAGTCTCCTGGTTGGAAGG - Intronic
1132285190 15:100657661-100657683 TTGGGAAACTCCTGGTTGGAAGG + Intergenic
1132353118 15:101152898-101152920 TTAGCAAGGTCCTGGTTTGAAGG + Intergenic
1135467959 16:22703454-22703476 TGGGGAATCTCCTGGTTTAATGG + Intergenic
1135702939 16:24648722-24648744 TTTGCAGTCTCCTAGTGTCAAGG + Intergenic
1135976265 16:27110519-27110541 GTGGCAGTGCCCCGGTTTGAAGG + Intergenic
1136448716 16:30340083-30340105 TTCTCAGTCTCCAGGTTTGATGG - Intergenic
1136512038 16:30744027-30744049 TTGGAAGGATCCTGGTTGGAAGG + Intronic
1138218171 16:55223990-55224012 TTGGCAGTCCAGTGGTATGAGGG - Intergenic
1138773128 16:59688256-59688278 GAGGCAGTCTCCTGGTGAGAGGG + Intergenic
1142047146 16:87932780-87932802 TTCTCAGTCTCCAGGTTTGATGG + Intronic
1147441685 17:40451445-40451467 TTTTCATTCTCCTGGTTTGGGGG - Intronic
1149559305 17:57596755-57596777 TTGACAGCCTCCTGGTCTGGGGG - Intronic
1150599007 17:66633817-66633839 TTGCCTGCCTCCTGGTGTGAAGG + Intronic
1151400578 17:73853324-73853346 TTGGCACTCATCTGGCTTGATGG - Intergenic
1160110000 18:76017314-76017336 TTGGGTGTCTCTTGGTTTGTGGG + Intergenic
1162096314 19:8311932-8311954 TTGCCAGCATCCTGTTTTGAGGG - Intronic
1166319197 19:42006035-42006057 CTTGCATTCTCCTGGGTTGAGGG - Intronic
1166673996 19:44728117-44728139 TTGACTGTCTCCTGGATGGATGG + Intergenic
1168726100 19:58582988-58583010 TTTGCAGTCTACAGGATTGAAGG - Intergenic
928330207 2:30351918-30351940 TTGGCAGCCTCCTCCTTGGAGGG - Intergenic
929038106 2:37715323-37715345 TTGGCAGTATGCTGGCTTCATGG + Intronic
929096679 2:38268920-38268942 TTGGCCATCTCTTGGTTTGATGG - Intergenic
929646449 2:43633309-43633331 TTGTCTGTCTCCTTGTTTGTAGG + Intergenic
931029395 2:58155484-58155506 TTGGTAGTCTCCTGGTGGGAAGG + Intronic
932575902 2:72962233-72962255 GTGACAGGCTCCTGGTGTGAAGG + Intronic
933494004 2:83025146-83025168 TTGGCAGCCTTCTGGTTTGCTGG - Intergenic
934159712 2:89237299-89237321 TAGACAGTCTCCTGCTGTGAGGG - Intergenic
934207567 2:89945132-89945154 TAGACAGTCTCCTGCTGTGAGGG + Intergenic
934276103 2:91574019-91574041 TGGGCAGGCTCCTGGTGTGGAGG + Intergenic
937223591 2:120355777-120355799 TTAGCATTCACCTGGTTAGAAGG + Intergenic
937755662 2:125535134-125535156 TTTGCAGTCTCCTGATTGGTTGG - Intergenic
939416908 2:141911800-141911822 TGGGCAGTCTCATGCTGTGAGGG + Intronic
939832291 2:147087476-147087498 TTGGCAGACTTCTCATTTGAGGG - Intergenic
939969361 2:148643225-148643247 TCTGCAGTCTCCTCCTTTGAAGG - Intergenic
945145503 2:206733896-206733918 CTGGCAGTCTCCTCCTTTGTAGG - Intergenic
945326171 2:208485351-208485373 ATAGCAGTCTTCTGGTTTGCTGG - Intronic
1171353689 20:24525821-24525843 TTTGCAGTCTCCTGTTGTGATGG + Intronic
1175176314 20:57114597-57114619 TTCGCAGTCTCCTGGGTTTCTGG + Intergenic
1175393960 20:58645966-58645988 TGGGCAGGCACCTGGTATGATGG + Intergenic
1181557219 22:23678036-23678058 TTGGGAGTCTCCAGGTGAGAGGG - Intergenic
1181697161 22:24599524-24599546 TTGGGAGTCTCCAGGTGAGAGGG + Intronic
949709021 3:6853372-6853394 TTGGCAGTTTCAGGGTTTTAGGG + Intronic
949839678 3:8306243-8306265 TGGGCAGTCTACTGCTTTGGTGG - Intergenic
950024327 3:9810177-9810199 ATGGCAGCCTCCTGGGTGGACGG - Exonic
951055285 3:18140054-18140076 CTACCAGTCTCCTGGTTTCAGGG + Intronic
952336588 3:32408685-32408707 TTGGCATTCTGATGGTTTGGGGG - Intronic
954868184 3:53747417-53747439 TTCACAGTCTCCACGTTTGAGGG + Exonic
957280320 3:78143237-78143259 CTGGCAATCTTGTGGTTTGATGG + Intergenic
958975929 3:100667931-100667953 TAGGGAATCTCCTGGTTTGTGGG + Intronic
961389545 3:126544126-126544148 TTGGTAGTTTACTGGATTGATGG + Intronic
962209547 3:133465695-133465717 TTGGATAACTCCTGGTTTGAGGG + Intronic
962308893 3:134312244-134312266 TTGGCAGACTCCTGGCCTGGAGG - Intergenic
963474832 3:145791695-145791717 TTGGGAATCTGCAGGTTTGATGG + Intergenic
964371418 3:156004225-156004247 GAGGGAATCTCCTGGTTTGAGGG + Intergenic
964927295 3:161975009-161975031 CTGACAGGCTCCTGGTTGGAAGG - Intergenic
965748647 3:171953307-171953329 ATGACTGTCTCCTGGTTTGTGGG + Intergenic
969474560 4:7414193-7414215 TTGGCAGGATCCTGGTTGGCTGG - Intronic
969928181 4:10604805-10604827 TTTGCAGTTTCATGGTGTGATGG + Intronic
971544320 4:27866294-27866316 TTGGCAGTAGCCTGTTTTCAGGG - Intergenic
973937977 4:55869958-55869980 TTGGCAGTTTCCTTATTTCAGGG + Intronic
975327083 4:73070485-73070507 CTGGCTGTCTTCTGGTTTAAAGG + Intergenic
978087923 4:104677377-104677399 GTGGCATTCCCCTGGTTTTACGG - Intergenic
978380886 4:108127291-108127313 TTAGCAGTCTCCTAGATTAAAGG - Intronic
981058950 4:140398847-140398869 TTACCAGTCTTCTGGTTTGACGG + Exonic
981256102 4:142661798-142661820 TGGACTGTCTCCTGTTTTGAAGG - Intronic
985199057 4:187465324-187465346 TTGGCAGACTCCAGGTTTTGTGG - Intergenic
985594920 5:783813-783835 TTGGGAGGCTGCTGTTTTGATGG - Intergenic
986722231 5:10567557-10567579 TCTGCAGGCTCCTGGTTTAAGGG + Intronic
992424502 5:76642574-76642596 TTCACAGTCTCTTGGTTTTATGG - Intronic
996011741 5:118488143-118488165 ATGGTAGTCTGCTGGTTTCAGGG + Intergenic
997603243 5:135154871-135154893 GTGGGAAGCTCCTGGTTTGATGG - Intronic
998967318 5:147554649-147554671 TTTGCAATATTCTGGTTTGAGGG - Intergenic
1000281595 5:159787103-159787125 TTGCCAGTCTCCTTGATTGCTGG + Intergenic
1000314679 5:160078136-160078158 TTAGCAGGCTGCTGGTTTCATGG - Intronic
1008453886 6:51685831-51685853 TTAGCAGTCTGCTGGTGTGAGGG + Intronic
1010139594 6:72599054-72599076 TTACCAGCCTCCTGGTTTTAAGG - Intergenic
1016370983 6:143373883-143373905 TTGGCAGTCTCCTAATTTAGTGG + Intergenic
1016430548 6:143980869-143980891 TTTGCAGACACTTGGTTTGAAGG - Intronic
1017638383 6:156465947-156465969 TTGAAAGTCTCCTGGCTTGAAGG - Intergenic
1018197188 6:161365770-161365792 CTTGCAGTGTCCTGATTTGAAGG - Intronic
1019006780 6:168804661-168804683 TTGAAAGTATCCTGGTTTGATGG - Intergenic
1020707560 7:11564635-11564657 TGGGCTGTCTCCTGATTTCAAGG + Intronic
1021025764 7:15664944-15664966 CTGGCAGTCTCCTGTTTCAAAGG + Intronic
1024757247 7:52549528-52549550 TTGTGACTCTCCTGCTTTGATGG + Intergenic
1030290086 7:107863672-107863694 TTTGCAGTCTCCTGGGGTGGAGG + Intergenic
1030907239 7:115201458-115201480 TTGGGAGTGTCTTGGTTAGAAGG + Intergenic
1033218435 7:139511253-139511275 TTGGTAAACACCTGGTTTGAGGG - Intergenic
1039145136 8:34438588-34438610 GAGGGAATCTCCTGGTTTGAGGG - Intergenic
1041635673 8:60140025-60140047 TTTGAAGTCTACTGGTGTGAAGG - Intergenic
1041884942 8:62797879-62797901 ATGGCATTCTCCTTGTGTGAGGG - Intronic
1042709449 8:71700059-71700081 TTGGGCTTCTCATGGTTTGATGG + Intergenic
1045850986 8:106697588-106697610 TTGGCAGTAGCCTGGGATGATGG - Intronic
1047800769 8:128307374-128307396 GGGGCAGTCTGCTGGTTTGATGG + Intergenic
1048020763 8:130537050-130537072 TTGGGAGTCTCCTGGGAAGAAGG - Intergenic
1048180440 8:132189492-132189514 TTAGCAGTCTCATGTTTTAAGGG - Intronic
1050134859 9:2451924-2451946 TTGGAAGTCTTCAGTTTTGATGG + Intergenic
1055007786 9:71528295-71528317 TTGGGTGTGTACTGGTTTGATGG - Intergenic
1058951119 9:109905022-109905044 TTTGCAGTCTCCTGGGTGTAAGG + Intronic
1061193428 9:129095073-129095095 TTGCCAGTCTCCTGCTCTGGAGG + Exonic
1062122478 9:134841234-134841256 TTTGCAGGCTCCTGGTTTGCGGG + Intronic
1062169752 9:135128463-135128485 CTGACAGTCTCCTGGTAGGAGGG - Intergenic
1186206689 X:7207963-7207985 TTCCCAGCCTCCTGGTTTGCAGG + Intergenic
1186876281 X:13821213-13821235 TTGGGAGCCTCCTATTTTGAGGG - Intronic
1187733059 X:22276159-22276181 TTGACATTCTCCAGGATTGAAGG + Intergenic
1187848591 X:23566988-23567010 TTGGCAGTTTACAGATTTGATGG + Intergenic
1191110925 X:56802774-56802796 TTGGCCCTCTCCAGGTTTCATGG - Intergenic
1194712126 X:97248720-97248742 TTGGCAGTCACCTTGTTTCAAGG + Intronic
1197347402 X:125340879-125340901 TGGGCAGTCTCATGCTGTGAGGG + Intergenic
1197819163 X:130528892-130528914 TTGGCAGTCACCTGGTTCTCTGG + Intergenic
1200703552 Y:6422514-6422536 CTGGAAAACTCCTGGTTTGAGGG - Intergenic
1200705255 Y:6437111-6437133 TTGGCAAACTCCAGATTTGAGGG - Intergenic
1200709085 Y:6467838-6467860 CTGGCAAACTCCTGTTTTGAGGG - Intergenic
1200914439 Y:8559008-8559030 TTGGCAAACTCGTGATTTGAGGG + Intergenic
1200922810 Y:8628280-8628302 ATGGCAAACTCTTGGTTTGAGGG + Intergenic
1200924369 Y:8641320-8641342 TTGGCAAACTCCCGATTTGAGGG + Intergenic
1200928126 Y:8672763-8672785 TTGGCAAACTGCTGATTTGAGGG + Intergenic
1200935897 Y:8738128-8738150 CTGGCAAACTCCTGATTTGAGGG - Intergenic
1200984814 Y:9293538-9293560 CTGGCAAACTCCTGATTTGAGGG - Intergenic
1201025027 Y:9696871-9696893 CTGGCAAACTCCTGTTTTGAGGG + Intergenic
1201028856 Y:9727597-9727619 TTGGCAAACTCCAGATTTGAGGG + Intergenic
1201030559 Y:9742193-9742215 CTGGAAAACTCCTGGTTTGAGGG + Intergenic
1202125625 Y:21566649-21566671 CTGGCAAACTCCTGATTTGAGGG + Intergenic
1202148815 Y:21826465-21826487 CTGGCAAACTCCTGATTTGAGGG + Intergenic
1202153383 Y:21862743-21862765 CTGGCAAACTCCTGATTTGAGGG - Intergenic
1202174132 Y:22081899-22081921 TTTGTAGGCCCCTGGTTTGAAGG + Intronic
1202182238 Y:22149549-22149571 CTGGCAAACTCCTGATTTGAGGG - Intergenic
1202182567 Y:22152080-22152102 CTGGCAAACTCCTGATTTGAGGG - Intergenic
1202208793 Y:22434322-22434344 CTGGCAAACTCCTGATTTGAGGG + Intergenic
1202209122 Y:22436853-22436875 CTGGCAAACTCCTGATTTGAGGG + Intergenic
1202217228 Y:22504483-22504505 TTTGTAGGCCCCTGGTTTGAAGG - Intronic
1202325958 Y:23691576-23691598 TTTGTAGGCCCCTGGTTTGAAGG + Intergenic
1202544813 Y:25978478-25978500 TTTGTAGGCCCCTGGTTTGAAGG - Intergenic