ID: 1124259410

View in Genome Browser
Species Human (GRCh38)
Location 15:28175317-28175339
Sequence CCTGCTTTGCAGCAGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 256}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124259410_1124259421 20 Left 1124259410 15:28175317-28175339 CCCAACCCCTGCTGCAAAGCAGG 0: 1
1: 0
2: 5
3: 34
4: 256
Right 1124259421 15:28175360-28175382 AGGAACAGGACCCGCCCTCATGG 0: 1
1: 0
2: 2
3: 10
4: 167
1124259410_1124259417 -7 Left 1124259410 15:28175317-28175339 CCCAACCCCTGCTGCAAAGCAGG 0: 1
1: 0
2: 5
3: 34
4: 256
Right 1124259417 15:28175333-28175355 AAGCAGGCAGATACACCAGTGGG 0: 1
1: 0
2: 3
3: 24
4: 189
1124259410_1124259418 0 Left 1124259410 15:28175317-28175339 CCCAACCCCTGCTGCAAAGCAGG 0: 1
1: 0
2: 5
3: 34
4: 256
Right 1124259418 15:28175340-28175362 CAGATACACCAGTGGGCAAAAGG 0: 1
1: 0
2: 2
3: 16
4: 159
1124259410_1124259419 6 Left 1124259410 15:28175317-28175339 CCCAACCCCTGCTGCAAAGCAGG 0: 1
1: 0
2: 5
3: 34
4: 256
Right 1124259419 15:28175346-28175368 CACCAGTGGGCAAAAGGAACAGG 0: 1
1: 0
2: 3
3: 26
4: 200
1124259410_1124259416 -8 Left 1124259410 15:28175317-28175339 CCCAACCCCTGCTGCAAAGCAGG 0: 1
1: 0
2: 5
3: 34
4: 256
Right 1124259416 15:28175332-28175354 AAAGCAGGCAGATACACCAGTGG 0: 1
1: 0
2: 7
3: 135
4: 1429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124259410 Original CRISPR CCTGCTTTGCAGCAGGGGTT GGG (reversed) Intronic
900330164 1:2130270-2130292 CCTGCTTTCCAGCTGGGGACTGG + Intronic
901040319 1:6359475-6359497 CATCCTCTGAAGCAGGGGTTGGG - Intronic
903307445 1:22423232-22423254 CATGCTTTGCACCAGGAGTAGGG + Intergenic
903395794 1:23000994-23001016 GTTGCTTTGTAGAAGGGGTTGGG + Intergenic
906378929 1:45319212-45319234 TTTGCTTTGTAGAAGGGGTTGGG - Intergenic
907288402 1:53396763-53396785 CCTGCTTCCCAGCAGGGCTATGG + Intergenic
907391895 1:54163593-54163615 CCTGCATAGAAGCAGGTGTTCGG + Intronic
907460734 1:54603994-54604016 CCTGCTTGTCAGAACGGGTTTGG + Intronic
907496875 1:54851297-54851319 GCTGCTCTGCAGCAGGGGCTGGG - Exonic
907938040 1:59060257-59060279 CCAGTTTTGGAGGAGGGGTTTGG - Intergenic
908028093 1:59971892-59971914 CCTGCTTTTCTGAAGGGCTTTGG + Intergenic
911481602 1:98449060-98449082 ACTACATTTCAGCAGGGGTTTGG - Intergenic
911661759 1:100509190-100509212 CCTCCTTTCCATCAGGAGTTGGG + Intronic
912307346 1:108582711-108582733 CCAGCTCTGTAGCAGGGTTTAGG + Intronic
912718382 1:111999304-111999326 CCAGCTTTTCTGCAGGGGTCTGG - Intergenic
913502281 1:119482326-119482348 CCTGATTTGCAGCAGTGGTGGGG + Intergenic
913517582 1:119617585-119617607 CCTGATTTGCAGCAGTGGTGGGG + Intergenic
914091854 1:144507506-144507528 GATACTGTGCAGCAGGGGTTTGG + Intergenic
914306685 1:146426358-146426380 GATACTGTGCAGCAGGGGTTTGG - Intergenic
914595364 1:149146444-149146466 GATACTGTGCAGCAGGGGTTTGG + Intergenic
915955396 1:160216503-160216525 CCTGCTTTGGTGTAGGGGTTGGG - Exonic
916918076 1:169431680-169431702 CCTGCTAGGGAGCTGGGGTTTGG - Intronic
918151075 1:181798698-181798720 CCAGCTATGCCGCAGGGGTGGGG - Exonic
920305567 1:205016143-205016165 CCTGCTTTGCAGAAGGGAAATGG - Intronic
920498432 1:206471371-206471393 CCTTCTTTGCACCAGGTGCTTGG + Intronic
921353113 1:214257845-214257867 GCTGCTGTGCAGCAGGGGTCGGG - Intergenic
922534052 1:226366851-226366873 CCTGCAGTGTTGCAGGGGTTTGG - Intronic
922668506 1:227492057-227492079 CCTGCTTTGAAGCAGGGGATAGG + Intergenic
923070547 1:230560601-230560623 CATGCTCTGCAGAAGGGGGTAGG - Intergenic
1063981238 10:11453514-11453536 TCTTCTTTGCAGCAGGGTTGAGG + Intergenic
1066416483 10:35226384-35226406 GCTGCCTTGCAGCAGGGGGAAGG + Intergenic
1067787951 10:49264596-49264618 GCTGCTGTGAAGCAGGGGATGGG - Intergenic
1069346629 10:67477349-67477371 CCTGCTTTGCCCCCGGGGGTGGG - Intronic
1070521300 10:77255938-77255960 CCTTCTTTGCATCAGGTGTTAGG - Intronic
1071187461 10:83060820-83060842 GTTGCTTTGTAGAAGGGGTTGGG - Intergenic
1073060848 10:100732603-100732625 CCTGCTTTGTAGCAGGGCAGAGG - Intergenic
1073793354 10:106962014-106962036 CCTGCTTTGCATCAGGAGGTTGG + Intronic
1074104989 10:110382700-110382722 CCTGCCGTGTGGCAGGGGTTTGG + Intergenic
1075334186 10:121597298-121597320 CCTGCTCTGCCGCAGCGGCTGGG - Intronic
1075945134 10:126426258-126426280 CCTGCTATGCAGCAGGTTCTGGG - Intronic
1076890262 10:133279950-133279972 CATGCTGGGCAGCAGGGGTGTGG + Intronic
1076890277 10:133280013-133280035 CGTGCTGGGCAGCAGGGGTGAGG + Intronic
1077466045 11:2734262-2734284 CCTGCTCTGCAGCTGGGCTCCGG - Intronic
1077720673 11:4625452-4625474 CCTGCTTCTCAGCTGTGGTTAGG + Intergenic
1078531126 11:12137378-12137400 CCTGCCTTGCTGTAGGGGCTTGG + Intronic
1078714281 11:13825154-13825176 TCTTTTTTGGAGCAGGGGTTGGG + Intergenic
1080994280 11:37580923-37580945 GTTGTTTTGTAGCAGGGGTTAGG + Intergenic
1081150700 11:39627285-39627307 CCTGCTTTCCAGCTGAGGTGGGG - Intergenic
1083104730 11:60346853-60346875 CCTGCTTTTCAGCTGCGGTGAGG + Intronic
1083969986 11:66069081-66069103 CCTGCTTTGTAGGAAGGCTTGGG + Intronic
1084476360 11:69391784-69391806 CCTGCTTGGCCGCCGGGGTCGGG + Intergenic
1085220739 11:74871908-74871930 CCTGCTTTTCAGCTGCGGTTAGG - Intronic
1085570412 11:77553534-77553556 GTTGCTTTGTAGAAGGGGTTGGG - Intronic
1086824271 11:91475831-91475853 CCTGCTGTGCTGGAGGGGCTGGG - Intergenic
1086949864 11:92880799-92880821 CCTCCATTCCGGCAGGGGTTTGG - Exonic
1089354680 11:117841922-117841944 CCTGCCTGGCAGGAGGGGTAGGG - Intronic
1089520118 11:119057467-119057489 GATGCTTTGCTGCCGGGGTTCGG + Intergenic
1090291845 11:125552867-125552889 CCTGCTTCTCAGCTGCGGTTAGG + Intergenic
1090892616 11:130939084-130939106 CCTGCTTTGCTGCCAGGGTATGG - Intergenic
1091341119 11:134814726-134814748 CCTGATTTCCAGCTGGGGTGGGG + Intergenic
1092029983 12:5275945-5275967 ACAGCTATGCAGAAGGGGTTTGG - Intergenic
1096148527 12:49295008-49295030 CCTGCTGTTCCGCAGGGGTGGGG + Exonic
1096560748 12:52434170-52434192 CCCGCTCTGCAGCAGGGAGTGGG - Exonic
1097077811 12:56408239-56408261 CCTGCTTTTCAGCAGTGTTCAGG + Intergenic
1097130481 12:56807549-56807571 CCTGCTTTTCAGCGGTGGTCAGG + Intergenic
1098353612 12:69588765-69588787 CCTGCTGTGCAGCCCAGGTTTGG - Intronic
1100964957 12:100002503-100002525 CTTGCCTTGCAGCTGGGGGTGGG - Intergenic
1101129290 12:101672236-101672258 CAGGCTCTGAAGCAGGGGTTTGG + Intronic
1102544701 12:113646086-113646108 CCTGCTTTGCAGAGGGGATGCGG + Intergenic
1102604706 12:114059503-114059525 GTTGTTTTGCAGAAGGGGTTGGG - Intergenic
1102861818 12:116342609-116342631 CCTCCCTTGCAGCAAGGGATGGG + Intergenic
1104257842 12:127155458-127155480 GTTGCTTTGTAGAAGGGGTTGGG - Intergenic
1105070967 12:133234442-133234464 CCTGCTTTGCAGAGTGGGTTGGG - Exonic
1106407178 13:29484299-29484321 CCTGCTCTGCAGGAGGGCTAAGG - Intronic
1107021953 13:35761026-35761048 CCTGATTTACAGCAGGACTTTGG + Intergenic
1114770829 14:25427748-25427770 GTTGCTTTGTAGAAGGGGTTGGG + Intergenic
1114946354 14:27686273-27686295 TCTGCAGTGCTGCAGGGGTTGGG + Intergenic
1118842688 14:69524898-69524920 CGCGGTTTGGAGCAGGGGTTGGG - Intronic
1119023385 14:71133850-71133872 CCTGGTTTGCCCCTGGGGTTTGG - Intergenic
1122313134 14:100809943-100809965 CCTGATCTGCAGCTGGGGCTTGG + Intergenic
1122554671 14:102571308-102571330 CCTGCTTTGCAGGCTGGGCTGGG + Intergenic
1123005203 14:105318052-105318074 CCTGCTCTTCAGCAAGGGCTGGG + Intronic
1202897902 14_GL000194v1_random:20642-20664 CCTGCTGTTCAGCTGGGGTATGG - Intergenic
1123663360 15:22586195-22586217 CCTACTCAGCAGCAGGGGTTGGG - Intergenic
1124259410 15:28175317-28175339 CCTGCTTTGCAGCAGGGGTTGGG - Intronic
1124317190 15:28680627-28680649 CCTGCTCAGCAGCAGGGGTTGGG - Intergenic
1124566260 15:30816847-30816869 CCTACTCAGCAGCAGGGGTTGGG + Intergenic
1124871840 15:33551462-33551484 CCTTCTTTGGTGCAGGGGTTCGG + Intronic
1125383696 15:39114419-39114441 CCTGCTCTGGAGCAGGGTATGGG + Intergenic
1126388835 15:48123030-48123052 TTTGCATTTCAGCAGGGGTTGGG - Intronic
1128729134 15:70008958-70008980 CCTTCTTTGCACCAGGGCCTGGG + Intergenic
1128768310 15:70264520-70264542 CCTCCTTTGCGGCGGGGTTTCGG - Intergenic
1128819951 15:70642910-70642932 CCTGCATTTAAACAGGGGTTGGG - Intergenic
1129259635 15:74357424-74357446 GTTGCTTTGTAGAAGGGGTTAGG - Intronic
1129711574 15:77822933-77822955 CCTGCTTTTCAGCCTGGCTTAGG - Intergenic
1129901927 15:79157879-79157901 CCTGCTTTGCCGCAGGCAGTGGG + Intergenic
1130301160 15:82680579-82680601 GCGGCTCTGCAGCAGGGGTTTGG + Exonic
1132340620 15:101076036-101076058 CTTGTTTTGTAGAAGGGGTTGGG - Intronic
1133175958 16:4014804-4014826 CCTGTTTAGAAGCAGGGGTGGGG - Intronic
1134824224 16:17271756-17271778 CCTGGTTCCCAGCAGGGGTCGGG - Intronic
1135808494 16:25566117-25566139 CCTGCCATACAGCAGGGGCTTGG - Intergenic
1137055139 16:35742075-35742097 TTTGCTTTGTAGAAGGGGTTGGG + Intergenic
1137704090 16:50521882-50521904 CTTGCATTACAGCAGGGCTTGGG + Intergenic
1138093998 16:54197958-54197980 CCTGCTCTGCAGGACGGCTTGGG + Intergenic
1139969491 16:70765053-70765075 CCTGCTTTGCATAAGGCCTTGGG - Intronic
1140886616 16:79249901-79249923 CCTGCTTTGCATCAGGCACTGGG - Intergenic
1141618386 16:85222821-85222843 CCTCCTCTGCAGCAGAAGTTTGG + Intergenic
1142163225 16:88570256-88570278 CCTGCGCTGTAGCGGGGGTTCGG + Intergenic
1143561173 17:7696075-7696097 CTTGCTTAGCTGGAGGGGTTAGG + Intronic
1143874513 17:9981642-9981664 CCTGCTTGGCAGCAGGCCTAAGG + Intronic
1144393892 17:14824628-14824650 ACAGCTTTGCTGGAGGGGTTTGG - Intergenic
1144440995 17:15281512-15281534 CCTGCTTTGGTGCAGAGGGTGGG - Intergenic
1145917558 17:28584533-28584555 CTTGCTTTGGAGCAGAAGTTTGG - Intronic
1146789411 17:35743037-35743059 CCTGCTGTGCTGCAGGACTTTGG + Exonic
1148223467 17:45881705-45881727 ACTGCTTTACAGCAGGGGAGGGG - Intergenic
1148884813 17:50764728-50764750 CCTGCTTTGCACCAGGCACTGGG + Intergenic
1149256572 17:54834323-54834345 CCTTCCTTGCAGCAGGGCGTGGG + Intergenic
1149794135 17:59504232-59504254 CCTGATTAGCAGGAGGAGTTTGG - Intergenic
1150338099 17:64344579-64344601 CCTCCTATGGAGGAGGGGTTGGG - Intronic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1150587958 17:66535483-66535505 CCTGTTTGGCAGCAGGGGTGGGG - Intronic
1150943756 17:69722289-69722311 CCTTATTAGCAGAAGGGGTTGGG - Intergenic
1151336213 17:73441166-73441188 GCTGCTTTACAGGAGGGGTGGGG - Intronic
1151415355 17:73958595-73958617 GCTGCTTTGCTGCTGGGGGTGGG + Intergenic
1152256017 17:79239849-79239871 CCTGTTTTGAAGCATGGGATTGG + Intronic
1152357360 17:79813592-79813614 CCTGCAATGCAGCAGGGGGAGGG - Intergenic
1152437183 17:80283597-80283619 CCTGCCTTGCAGGAGGGGAGTGG - Intronic
1152525794 17:80887599-80887621 CCTGCTGTGGGGCTGGGGTTGGG + Intronic
1152721269 17:81924877-81924899 TGTGCTTAGCAGCAGGGGTGGGG - Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153881486 18:9425328-9425350 GCTGCTTTGTAGAAGGGGTTGGG + Intergenic
1154173180 18:12065605-12065627 CCAGATGTGCAGCAGGGGATGGG - Intergenic
1155504946 18:26524180-26524202 CCTGCTTTCCAGCAGGGGTAGGG + Intronic
1157414492 18:47490561-47490583 CCTGCTTTGAAGCACTGGCTGGG + Intergenic
1157582539 18:48781979-48782001 ACTGCTTTGAAGCAGGGGCTGGG + Intronic
1157601130 18:48893866-48893888 TCTGCCTTGAAGCAGGGGTGCGG - Intergenic
1160237337 18:77096693-77096715 CCTGCTTTTCAGCTGTGGGTGGG - Intronic
1161712349 19:5856082-5856104 TTTGCTTTGTAGGAGGGGTTGGG - Intergenic
1161781686 19:6297388-6297410 CCGGCTCTGCAGCTGTGGTTTGG - Intergenic
1162099255 19:8329943-8329965 CCTGCTTTGCAGCAAGGATTAGG + Intronic
1162273976 19:9638602-9638624 GTTGCTTTGTAGAAGGGGTTGGG + Intronic
1162286888 19:9745474-9745496 GTTGCTTTGCAGAAGGGGTTGGG - Intergenic
1164062123 19:21684632-21684654 CCTGCTTTTCAGCTGTGGTTGGG - Intergenic
1164187572 19:22884130-22884152 CCTGCTTTTCAGCTGTGGTTGGG - Intergenic
1164686527 19:30169758-30169780 CCTGCCATGCAGCAGGGTTTGGG - Intergenic
1166295133 19:41885210-41885232 CCTGTTTAGGAGGAGGGGTTTGG - Intronic
1167520644 19:49952394-49952416 CCTGCATGGGAGCAGGGTTTGGG + Exonic
924964121 2:59713-59735 CCTGCTTTTCAGCAGTGGTGAGG - Intergenic
925433628 2:3817941-3817963 GCTGTTTTGTAGAAGGGGTTGGG + Intronic
925902968 2:8521681-8521703 CCTTCCTTGCAGCAGGAGATGGG + Intergenic
926142466 2:10375945-10375967 CCAGCATTGCAGGAGGGGTCTGG + Intronic
927927208 2:27022200-27022222 CTTGCTTTCCAGCTGGGGTATGG + Exonic
928239706 2:29575873-29575895 GGGGCTTTGCAGCAGGGGTGTGG + Intronic
928244898 2:29618612-29618634 GCAGCTTTGCACCAGGGGTTAGG - Intronic
929313426 2:40451395-40451417 CCTGTTTTCCAGCGGGCGTTGGG - Intronic
931538319 2:63302238-63302260 CCTGCTTCTCAGCTGTGGTTAGG - Intronic
931696605 2:64875577-64875599 TTTGTCTTGCAGCAGGGGTTGGG + Intergenic
932973757 2:76576063-76576085 CTTGTTTTGTAGAAGGGGTTGGG + Intergenic
933226881 2:79759952-79759974 CCTGCTTTGGAGCATGGCTGAGG - Intronic
935585808 2:104799084-104799106 TCTGCTTTTCAGCAGGGCCTGGG - Intergenic
935682829 2:105652673-105652695 CCTGCTTCCCAGGAGTGGTTTGG + Intergenic
937594777 2:123660157-123660179 GTTGCTTTGTAGAAGGGGTTGGG + Intergenic
939562533 2:143749934-143749956 CCTGGTGTGCAGCCAGGGTTAGG - Intronic
940468019 2:154057628-154057650 CCAGCTCTGCAGCAGAGGTGAGG + Intronic
943441476 2:187932648-187932670 CCTGCTTTTCAGCAGTAGTCAGG + Intergenic
947611902 2:231530060-231530082 GCTGCTGTGCAGCGGGGGTGAGG - Intronic
947795023 2:232889194-232889216 CGTGCTGTTCAGCAGGGATTTGG - Intronic
947829273 2:233127174-233127196 GCAGCTTTCCAGGAGGGGTTAGG + Intronic
948584955 2:239013466-239013488 CCTGCCTTGCTGCAGGGCCTGGG + Intergenic
1170675427 20:18475631-18475653 CCAGCTCTGGAGCAGGGGTGGGG - Intronic
1172270735 20:33654440-33654462 CCTGCTTTGTGGCAGGTGCTGGG - Intergenic
1172850476 20:37959082-37959104 TCTGCTTGGGAGCAGGGGTGGGG - Intergenic
1174008357 20:47428441-47428463 CATGCTTTGTAGCAGGGGTTGGG + Intergenic
1174434721 20:50498031-50498053 CCTCCTTTGCATCAGGGCATGGG - Intergenic
1175324233 20:58111365-58111387 CCTGCTTTGAAGCCGGGGGCTGG - Intergenic
1176041113 20:63066340-63066362 TCTGCTTTGCAGCAGGCCTGAGG - Intergenic
1176617584 21:9036631-9036653 CCTGCTGTTCAGCTGGGGTATGG - Intergenic
1179003303 21:37484005-37484027 CCTGCTGTGTAGCCCGGGTTGGG - Intronic
1179174809 21:39000675-39000697 CCTGCTTTGCAGCAGAGCCAGGG - Intergenic
1179534178 21:42040611-42040633 CTTGCTTGGTAGCAGGGGCTAGG + Intergenic
1180155568 21:45975586-45975608 CCTGCCTTGGGGCTGGGGTTGGG + Intergenic
1180955290 22:19738677-19738699 CCTGCTTTGGAGGAGGGGGTGGG - Intergenic
1182793018 22:32968708-32968730 CCTGATGTGCAGCTGGGTTTGGG - Intronic
1185363381 22:50422818-50422840 GGTGCTATGCAGCAGGGGTCGGG - Intronic
949562165 3:5213139-5213161 TCTGCCTTGCAGCCTGGGTTGGG + Intronic
951173989 3:19577788-19577810 CCTACATAGCAGCAGGTGTTTGG - Intergenic
952386195 3:32843239-32843261 CCTGCATGGTAGCAGGGGGTGGG + Intronic
952943854 3:38462972-38462994 CTAGCATTTCAGCAGGGGTTGGG - Intronic
954363292 3:50133684-50133706 CCTGCTTTGCTGGTGGGGTGGGG - Intergenic
954899267 3:54005230-54005252 CCTGCTTTGCAAATGAGGTTTGG + Intergenic
955073096 3:55588279-55588301 CCTGGTTGGAAGGAGGGGTTGGG - Intronic
955357047 3:58239760-58239782 CCTGGTTTGCAGTATGCGTTGGG + Intronic
955894815 3:63687852-63687874 CCCCCTTTGAAGCAGGGTTTAGG - Intergenic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
957985909 3:87572975-87572997 GTTGCTTTGTAGAAGGGGTTGGG - Intergenic
959748599 3:109806985-109807007 CCTGATTTGAAGCAAGGGTTTGG + Intergenic
964478860 3:157122310-157122332 GCTGCATTGCATCAGGGGTCTGG - Intergenic
966820287 3:183918789-183918811 ACTGCTTTGCTACAGGAGTTTGG + Intergenic
967689345 3:192456365-192456387 CCTGCTTGACAGCAGGCTTTGGG - Intronic
970451302 4:16168812-16168834 GCTGCTTAGCAGCAGGGCCTGGG - Intronic
970736243 4:19171939-19171961 CCTGGTTAGCAGCATAGGTTTGG + Intergenic
972415127 4:38832216-38832238 CCTTCTTTGCAGAGGGGGTGAGG - Intronic
976269551 4:83217321-83217343 CCTGCTAGGCACCAGGGGATGGG + Intergenic
977472346 4:97456468-97456490 TCTGCATTGGAGGAGGGGTTTGG - Intronic
978212725 4:106157289-106157311 CATGCTGTGCAGCCTGGGTTTGG + Intronic
979633218 4:122926875-122926897 ACTGCTTTGAAGCAGGAATTGGG - Intronic
980642436 4:135597489-135597511 CCTGCTTCTCAGCTGTGGTTAGG - Intergenic
981726060 4:147848408-147848430 CTGGCTTTGCAGCAGGAGATCGG + Intronic
981919726 4:150074617-150074639 ACTGCTTTTCAACAGGGGTAGGG - Intergenic
984411947 4:179406795-179406817 GTTGCTTTGTAGAAGGGGTTGGG - Intergenic
984805651 4:183749047-183749069 GCTGCTTGGCTGCTGGGGTTGGG - Intergenic
987266475 5:16261350-16261372 CCTGCTTTGCACAAAGGATTTGG - Intergenic
988196696 5:28013861-28013883 CCTGCTTTTCAGATGCGGTTGGG - Intergenic
989849729 5:46194112-46194134 CCTGCTTGGGGGCAGGGGTCAGG - Intergenic
990052781 5:51528890-51528912 CATCCTTTGCAGCAGGAGGTGGG + Intergenic
994325107 5:98438221-98438243 GTTGCTTTGTAGAAGGGGTTAGG - Intergenic
995231630 5:109771626-109771648 CCTGCTTTCTAGCTAGGGTTGGG + Intronic
996052412 5:118948943-118948965 GTTGCTTTGTAGAAGGGGTTAGG + Intronic
997157523 5:131575521-131575543 GTTGCTTTGTAGAAGGGGTTGGG - Intronic
997847139 5:137296878-137296900 CCCGTTTTGCAGGAGGGCTTGGG - Intronic
998160723 5:139811396-139811418 TCTGCTAGGCAGCAGGGGCTGGG + Intronic
998169497 5:139864154-139864176 CCTGCTCTGCAGGATGGGATGGG + Intronic
998236530 5:140402558-140402580 CCTGCTTTGGAGTTGGGGGTGGG + Intronic
998862811 5:146460893-146460915 CCTGCCTTGCCACAGAGGTTTGG - Intronic
999045798 5:148468182-148468204 ACTGCCTGGCAGCAGGTGTTAGG + Intronic
999327661 5:150653056-150653078 CCTGCTTTGGGTCTGGGGTTGGG + Exonic
1000121588 5:158203138-158203160 CCTGCTCTCCAGCTGGGCTTTGG + Intergenic
1000607161 5:163337668-163337690 GTTGCTTTGTAGAAGGGGTTGGG - Intergenic
1001825615 5:174742809-174742831 CCTGCTCTCCTGGAGGGGTTGGG - Intergenic
1001919819 5:175591028-175591050 CCTGCTGTACACCAGGGCTTGGG - Intergenic
1001928068 5:175653569-175653591 CCTGCCTTGCCGGAGGGCTTTGG - Intergenic
1002774988 6:320903-320925 CCTACCTTGCAGCAGGGATTGGG + Intronic
1003099963 6:3169525-3169547 GCTGTTTTGTAGAAGGGGTTGGG - Intergenic
1003432935 6:6056607-6056629 GCTTCTTTGCAGCAGAGGTTGGG + Intergenic
1005181717 6:23114333-23114355 CCTGCTTTTCAGCCGCAGTTAGG + Intergenic
1006574717 6:35036484-35036506 GTTGCTATGCAGCAGAGGTTTGG - Intronic
1006887327 6:37393533-37393555 CCTTCTTTACAGCAGGGCTCTGG + Exonic
1007082119 6:39115011-39115033 CCTGACTGGCAGCAGGGGGTTGG + Exonic
1007780971 6:44254564-44254586 CCAGCTCTGCAGCAGGGGATTGG - Exonic
1010249897 6:73696376-73696398 GCTGCTGTGCAGCAGCGGGTGGG + Intronic
1012139816 6:95612008-95612030 CCTGCTTTACTGCAGTGGCTAGG - Intergenic
1017270018 6:152493769-152493791 GTTGCTTTGTAGAAGGGGTTGGG - Intronic
1020794427 7:12663198-12663220 GCTGTTTTGTAGAAGGGGTTGGG - Intergenic
1023117527 7:36876768-36876790 CCTGCTTTGGGGCAGGAGTTAGG - Intronic
1023364147 7:39446215-39446237 CCTCCATTGCAGCACGGGGTGGG + Intronic
1023401491 7:39795096-39795118 CCTGCACAGCAGCAGGGGTAGGG + Intergenic
1023640430 7:42251449-42251471 CCTGCTGTGCAGCTGGAGTAGGG + Intergenic
1023817499 7:43961890-43961912 TCTGCTCTGCAGAATGGGTTTGG + Intergenic
1024739030 7:52335696-52335718 GTTGCTTTGTAGAAGGGGTTGGG + Intergenic
1025783241 7:64620429-64620451 CCTGCTTTTCAGCTGCAGTTAGG - Intergenic
1032616692 7:133480282-133480304 CCTGCTTGGCAGCAGATGCTGGG - Intronic
1033141191 7:138828209-138828231 CCTGCTTTACTGCAGTGGTCTGG + Intronic
1033365734 7:140671793-140671815 TCCGCTTTTCAGCGGGGGTTGGG - Intronic
1035277890 7:157758769-157758791 TCTGCTGTGCAGCAAGGGTTGGG - Intronic
1036549896 8:9806602-9806624 GTTGCTTTGCAGAAGGGGTTGGG - Intergenic
1039273849 8:35913502-35913524 CCTGCTACACAGCAGGGTTTTGG - Intergenic
1039498779 8:38000743-38000765 GTTGCTTTGTAGAAGGGGTTGGG + Intergenic
1039508135 8:38067157-38067179 TCTGATTTGCAGCTGGGGGTTGG - Intergenic
1043106294 8:76115982-76116004 CTTTCTTGGGAGCAGGGGTTTGG - Intergenic
1044008460 8:86964443-86964465 CCTGCTTTTCAGCAGTGGTCAGG + Intronic
1046404818 8:113759594-113759616 CTTGCTTTTTAGCAGGGCTTAGG + Intergenic
1047755369 8:127913967-127913989 CCTGCTTTTCAGTAGTGGCTGGG + Intergenic
1047866951 8:129035194-129035216 CCTGCGAGGCAGCAGGGGTGGGG + Intergenic
1049306312 8:141906140-141906162 CCTGCTTGGCAGCAGAGCTCAGG + Intergenic
1052215630 9:25963153-25963175 CCTGCTTCTCAGCTGTGGTTAGG + Intergenic
1052711598 9:32063332-32063354 CTGGCTTTGCAGAATGGGTTTGG - Intergenic
1053076856 9:35140911-35140933 CCTGCTTTGCAGCATTGGTCAGG - Intergenic
1057468422 9:95337216-95337238 CCGGGTCTGCAGCTGGGGTTTGG - Intergenic
1057938193 9:99258116-99258138 CCTGCCTTCCAGGAGGGCTTGGG - Intergenic
1059300589 9:113309876-113309898 CCAGCTTTGGATCAGGGGGTTGG - Intergenic
1059529487 9:115022950-115022972 CCTGACATGCAGCAGGTGTTGGG - Intronic
1060550707 9:124483770-124483792 CCTGCATTGCAGCATGAGATGGG - Intronic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1062007002 9:134244003-134244025 CTTGTCTTGCAGCAGGAGTTGGG - Intergenic
1062054109 9:134462042-134462064 GCTGATTTGCAGGAGGAGTTTGG + Intergenic
1062353116 9:136148725-136148747 CTTGCTGGGCAGCAGGGGCTGGG + Intergenic
1189125173 X:38438078-38438100 CCTGTTCTGCAGCAGGTCTTGGG - Intronic
1189954102 X:46260800-46260822 CCTGCCCAGCAGCAGGGGATAGG + Intergenic
1191015524 X:55805949-55805971 CTTGCTCTGCATCAGGGCTTTGG + Intergenic
1191274086 X:58516989-58517011 CCTCCTTTTCTGCAGTGGTTAGG - Intergenic
1191754892 X:64582339-64582361 CCTGCTTTGCAGGATGGCTGAGG + Intergenic
1192213999 X:69145303-69145325 CTTGCTTTGCAGCAAGAGCTGGG + Intergenic
1192546008 X:72014957-72014979 CCTCCTTTGCTGGTGGGGTTGGG + Intergenic
1192955452 X:76065155-76065177 CCAGTTTTGGAGGAGGGGTTTGG - Intergenic
1193000110 X:76554246-76554268 CCTGTTTTTCATCAGTGGTTAGG + Intergenic
1193070469 X:77300709-77300731 CCTGTTTTTCAGCAGGGATCTGG - Intergenic
1193560751 X:83013426-83013448 CCTGTTTTTCAGCAGCGGTTAGG + Intergenic
1194491861 X:94560810-94560832 CCTGCTTCACAGAAGGGATTTGG - Intergenic
1197356028 X:125438197-125438219 CCTGCTTTTCAGCTGCAGTTAGG + Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1198616492 X:138463600-138463622 CCTGCTTTGCTGGAGGTGGTAGG - Intergenic
1199343266 X:146707944-146707966 CCTGCTTAGCCCCAGGGGGTGGG + Intergenic
1200000571 X:153057755-153057777 GCTGCCTTGCAGCAGGTGTTCGG + Exonic
1200043672 X:153388272-153388294 CCTGCCTGGGAGCAGGGCTTTGG + Intergenic
1200145911 X:153926470-153926492 GCTGCTTGGCAGCGGGGCTTTGG - Intronic
1202067114 Y:20951514-20951536 CCTGTTTTTCATCAGTGGTTAGG + Intergenic