ID: 1124266459

View in Genome Browser
Species Human (GRCh38)
Location 15:28239498-28239520
Sequence CCTGCTAACCAGACAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 8, 1: 0, 2: 1, 3: 21, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124266455_1124266459 -5 Left 1124266455 15:28239480-28239502 CCTGTACAAATTGTACCTCCTGC 0: 6
1: 0
2: 0
3: 11
4: 111
Right 1124266459 15:28239498-28239520 CCTGCTAACCAGACAGCAGAGGG 0: 8
1: 0
2: 1
3: 21
4: 182
1124266454_1124266459 -1 Left 1124266454 15:28239476-28239498 CCTTCCTGTACAAATTGTACCTC 0: 6
1: 2
2: 1
3: 18
4: 113
Right 1124266459 15:28239498-28239520 CCTGCTAACCAGACAGCAGAGGG 0: 8
1: 0
2: 1
3: 21
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124266459 Original CRISPR CCTGCTAACCAGACAGCAGA GGG Intronic
900966405 1:5961830-5961852 GCTGCAGACCAGACACCAGAAGG + Exonic
901151042 1:7101451-7101473 CCTCCTAGCCAAACAGCACAGGG - Intronic
901654381 1:10760997-10761019 CCTGCCAGCCAATCAGCAGATGG + Intronic
905036335 1:34920310-34920332 CCTGCCAGCCAGGCTGCAGAGGG - Intronic
905775211 1:40663933-40663955 CCTGCTACCCACATAGCAGCTGG + Intronic
908895758 1:68896751-68896773 CCTATTAACCAGACAGAAGTAGG - Intergenic
910266564 1:85344412-85344434 CCTGCTGCCCGGCCAGCAGATGG + Intronic
910370993 1:86514831-86514853 CTTGCTACTCAGACTGCAGATGG + Intergenic
913118123 1:115715079-115715101 CCTGCTGGCCAGACTCCAGAGGG - Intronic
914782736 1:150800344-150800366 CCTCCTACCCACACAGCAGCTGG - Intronic
915633854 1:157172985-157173007 GCTGCCCACCAGGCAGCAGAAGG + Intergenic
916124380 1:161556339-161556361 CAGGCTAATCAGACAGCAGTTGG - Intergenic
916134270 1:161637697-161637719 CAGGCTAATCAGACAGCAGTTGG - Intronic
916804112 1:168242087-168242109 CATTCTAAGCAGGCAGCAGAAGG - Intronic
920161306 1:204000010-204000032 CCTGAGAACCAGACAGCAAGTGG - Intergenic
920169259 1:204060311-204060333 CCTGCATTCCAGCCAGCAGAAGG + Intergenic
920334093 1:205232627-205232649 CCTGCTAAGAATACAGCATACGG + Intronic
922217975 1:223536173-223536195 CCCGCTCACCTGACCGCAGAGGG - Intergenic
922219230 1:223545024-223545046 CCTGCTGTTCAGACAGCAAAGGG - Intronic
924449422 1:244164160-244164182 CCTGCTTACCACACTGGAGAAGG - Intergenic
1062826708 10:574976-574998 TCTGCCCACGAGACAGCAGAGGG + Intronic
1065459244 10:25938731-25938753 CATGCTAAGAAGACAGCAGATGG - Intronic
1066228571 10:33409317-33409339 GCTGCTAACCAAAAAGCTGAAGG + Intergenic
1069099932 10:64307596-64307618 CCAGATAACTAGACGGCAGAAGG - Intergenic
1069651942 10:70055045-70055067 CCTGGGAACCAGACAGAAGATGG - Intronic
1078604783 11:12765579-12765601 ACTGCTAAGGAGAAAGCAGATGG + Intronic
1079445738 11:20554871-20554893 CCTCTTCACCAGACGGCAGAAGG + Intergenic
1079450399 11:20596402-20596424 GCTGCAACCCAGACAGGAGAGGG - Intergenic
1081801272 11:45860941-45860963 CTTGGTGACCAGCCAGCAGATGG + Exonic
1083322231 11:61854901-61854923 CCTGCTTGCCAGGCAGCAGCAGG - Intronic
1085277725 11:75310682-75310704 GCTGATAATCAGACAGCACAGGG - Intronic
1085450492 11:76629322-76629344 ACTGCGACCCAGACAGGAGAAGG - Intergenic
1087664765 11:101031382-101031404 TCCACTAACCAGACAGCAGCTGG - Exonic
1090915832 11:131161264-131161286 CCTGCTGACCTGCCAGGAGAAGG - Intergenic
1093316749 12:17661379-17661401 CTAGCTACCCTGACAGCAGAGGG - Intergenic
1094460721 12:30695096-30695118 CCTGCCAACCCGACAGGAGGAGG + Intronic
1096113890 12:49043971-49043993 CCTGCTGACCTGCCTGCAGAGGG - Exonic
1098520786 12:71433133-71433155 GCTGCTGACCTGACAGGAGATGG - Intronic
1098881299 12:75920084-75920106 CCTGCAAACAAGCCAGCTGAGGG + Intergenic
1102949494 12:117020778-117020800 GCTGAAAACCAGACAGGAGAGGG - Intronic
1111793277 13:92885625-92885647 CCTGCTGATCTGACAGGAGATGG - Intergenic
1112607988 13:100926866-100926888 CCTGAGAGCCAGACAGCTGATGG - Intergenic
1114952938 14:27779942-27779964 CCTGCTAAACAGAAAGCACCAGG + Intergenic
1115034492 14:28840702-28840724 CTTGGTAACCACACTGCAGAAGG - Intergenic
1115152626 14:30302871-30302893 CCTTCCAACCAGAGAGCAAAAGG + Intergenic
1115785207 14:36817696-36817718 CCTGTGAACAAGTCAGCAGATGG + Intronic
1119430798 14:74567046-74567068 CCTGCTTCCCAGACAGCTCAAGG + Intronic
1119626909 14:76185288-76185310 GCTGCTGCCCAAACAGCAGATGG + Intronic
1119643439 14:76330946-76330968 CCTGCTAGACAGCCTGCAGATGG + Intronic
1121455525 14:94036516-94036538 CCTGCTGACAAGATAGCACAAGG + Intronic
1121656259 14:95598019-95598041 CCTGCTAATCAGGCAGGAGCCGG + Intergenic
1123460238 15:20463769-20463791 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1123657824 15:22536648-22536670 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1123695418 15:22875709-22875731 CCTGCAAACAACACAGGAGATGG + Intronic
1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG + Intronic
1124266459 15:28239498-28239520 CCTGCTAACCAGACAGCAGAGGG + Intronic
1124311733 15:28631846-28631868 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1124829690 15:33136198-33136220 CTTGCTAAGTAAACAGCAGAGGG - Intronic
1128242866 15:66113333-66113355 CCTGAAAACCATACTGCAGAGGG + Intronic
1130062674 15:80580977-80580999 CTTGGTAACCAGACTCCAGAGGG + Intronic
1130082848 15:80749621-80749643 CACGCAAACCAGACATCAGAGGG - Exonic
1130412994 15:83662915-83662937 TCTGCTACCCAGAGGGCAGAGGG - Intronic
1131247993 15:90812520-90812542 CCTACTAGCCAGAAGGCAGAGGG - Intronic
1131337896 15:91567523-91567545 CCTCATAGCCAGAAAGCAGAAGG - Intergenic
1132161347 15:99545822-99545844 CCTGCTTACCAGACAACAAATGG - Intergenic
1133902342 16:9988873-9988895 CATGATAACCAGACAGGAGGAGG + Intronic
1134684059 16:16146529-16146551 CCTGCTAACGAGACTGCTGTTGG - Intergenic
1135122622 16:19779551-19779573 GCTGCTATCCAGATGGCAGATGG - Intronic
1136382503 16:29901994-29902016 AATGAGAACCAGACAGCAGACGG - Intronic
1136704653 16:32176944-32176966 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1136763260 16:32752462-32752484 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1136804840 16:33117924-33117946 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1139636487 16:68261312-68261334 CCTGCTGACCAGGCAGGAGCAGG - Intergenic
1140480253 16:75258555-75258577 CTTGCAAAGCAGACAGCAGAGGG + Intronic
1141357824 16:83365183-83365205 CCTGAGAACCAGAGAGCTGATGG + Intronic
1203065411 16_KI270728v1_random:1012784-1012806 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1143087463 17:4426814-4426836 CATGCAAACCACACAGCAGTGGG - Intergenic
1143584172 17:7843202-7843224 CCGGGGAACCAGACAACAGAGGG - Intronic
1144091112 17:11857397-11857419 CCTGCTAATAACACAGGAGATGG + Intronic
1145012727 17:19378821-19378843 CCTGCTCCCCAGCCCGCAGAGGG + Intronic
1145239980 17:21235472-21235494 CCTGCCACCCACACAGCAGATGG - Intergenic
1147041076 17:37719550-37719572 CCTGGGAGCCAGACTGCAGAAGG - Intronic
1147982004 17:44280511-44280533 CCTGCTGCCCTGAAAGCAGAGGG - Intergenic
1149698172 17:58633479-58633501 CATACTACCCAAACAGCAGAGGG + Intronic
1151263822 17:72938199-72938221 CCTGCCACCCAGAAAGGAGACGG + Intronic
1151304098 17:73251888-73251910 CGTGCTACCCAGCTAGCAGAAGG + Intronic
1151824133 17:76514166-76514188 CCTGCTAGCCAGGCAGGGGAAGG + Intergenic
1154221247 18:12456596-12456618 TGTGCTAGCAAGACAGCAGATGG + Intronic
1155955544 18:31953878-31953900 CCTGCAGGCCAGAAAGCAGATGG - Intergenic
1156385304 18:36599155-36599177 CCCCATACCCAGACAGCAGAGGG - Intronic
1157438150 18:47688859-47688881 CCTGCCAACCACATAGCAAATGG + Intergenic
1159565285 18:70041405-70041427 CCTGAAAACGAGAAAGCAGATGG + Intronic
1159782466 18:72675822-72675844 CCTTCTAACAAGCCAGCAGTTGG + Intergenic
1161708254 19:5832403-5832425 CCCGCTTCCCAGACAGCACAGGG - Exonic
1162445307 19:10718929-10718951 ACAGCTAGCCAGACAGCAGGGGG - Intronic
1162540196 19:11291000-11291022 CCAGCTGCCCAGACAACAGAGGG + Intergenic
1165004217 19:32791318-32791340 CCTGGAAACCTGACTGCAGAAGG - Intronic
1165145637 19:33728358-33728380 GCTGCTACCCAGGAAGCAGAGGG - Intronic
1165894515 19:39133616-39133638 CCTGGAATGCAGACAGCAGAAGG - Intronic
925429450 2:3778480-3778502 TCTGCTGACCAGGGAGCAGAGGG + Intronic
927615183 2:24586829-24586851 CCTGGGAGCCAGACAGCATAAGG - Intronic
927950740 2:27167101-27167123 CATGCCAACCAGAAAGCAGAGGG - Intergenic
928653431 2:33425380-33425402 CCTGCTAACCATACAACAAAAGG + Intergenic
928737351 2:34307686-34307708 CCTTCTCACCTGACAGCAAATGG + Intergenic
929527990 2:42724085-42724107 CCTGATGTCTAGACAGCAGAAGG + Intronic
929551888 2:42898876-42898898 CCTGATAACCAGAGAGCAAATGG - Intergenic
930855322 2:56009958-56009980 TCTGCAAACCAGACAGAAGAGGG - Intergenic
932607431 2:73174809-73174831 CCTGCTCACCAGATCCCAGAGGG + Intergenic
934484380 2:94689497-94689519 CCTGCTAAACAGAAAGCACCAGG - Intergenic
935120521 2:100180000-100180022 CCCTCTAACCAGAAGGCAGAGGG - Intergenic
935738826 2:106128581-106128603 CCTGAGAACCAGAGAGCCGAGGG - Intronic
936049299 2:109211170-109211192 CCTGCTGACCTGAAAGCAGGTGG + Intronic
937248391 2:120508869-120508891 CCTGGGACCCAGACAGCATAAGG + Intergenic
942336871 2:174898102-174898124 CCAGCTAATGAGACGGCAGAGGG - Intronic
946541612 2:220690098-220690120 CCTGCTAATCTGACAGGAGGAGG + Intergenic
946715873 2:222554765-222554787 CCTGCTTTGCAGACAGCAGCGGG + Intronic
947897784 2:233691614-233691636 CCTGCTAACCACACTGCTGAGGG - Intronic
1169046580 20:2538164-2538186 CCCGACAACCAGACAGCAGCGGG - Intronic
1179496508 21:41775227-41775249 CCTCCCCACCAGACAGAAGATGG - Intergenic
1179525167 21:41971308-41971330 CCTGCTACCCAGGCAGGGGAGGG + Intergenic
1180745685 22:18087416-18087438 CCTGCTCAGCATTCAGCAGACGG - Intronic
1182149125 22:28016457-28016479 GCTGCCATCCAGACAGCAGATGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182836983 22:33350261-33350283 CCTGCTATCAAGACAGCATCAGG - Intronic
1183477313 22:38042732-38042754 GCTGCTGACCACACAGAAGAGGG + Intergenic
1184808171 22:46809753-46809775 CCTGCTAACCACTCCGCAGATGG - Intronic
1185215868 22:49599770-49599792 CCTGCTCTCCAGACACCAGCTGG - Intronic
950770754 3:15309035-15309057 TCTGCTGAGAAGACAGCAGATGG + Intronic
950917304 3:16658990-16659012 GCTGTTAACCACACAGCAGTTGG - Intronic
952538957 3:34345869-34345891 CCTGCTAACCAGGTAGCACTAGG + Intergenic
953024898 3:39139155-39139177 CCTGGAGACCAGACAGGAGAGGG - Intergenic
953718107 3:45333181-45333203 CATGGTACCCAGACAGCAGGAGG + Intergenic
956210539 3:66797574-66797596 CCTGCTAACCAGAGACCTGAAGG + Intergenic
956210706 3:66798679-66798701 CCTGCTACCCAGAAACCTGAAGG + Intergenic
957801565 3:85090720-85090742 GCTGCTAATCTGACAGCAGGTGG - Intronic
958716404 3:97787766-97787788 GCTCCTAACCAGAGGGCAGATGG + Intronic
958888466 3:99755794-99755816 CCTGGTAACTAAAGAGCAGATGG + Intronic
960170362 3:114454057-114454079 TCTTCTAACCAGACAGCGGGAGG - Intronic
961648204 3:128403877-128403899 CCAGATCTCCAGACAGCAGAAGG - Intronic
962263652 3:133930522-133930544 TCTGCTAAGCAGTCACCAGATGG + Intergenic
962829281 3:139125810-139125832 CCTGCTGAGCAGACAGAAGTGGG + Intronic
962937694 3:140096215-140096237 CCAGCTCCCCAAACAGCAGAGGG + Intronic
964482458 3:157155163-157155185 CTTGCAATCCAGACAGAAGACGG + Intronic
965126342 3:164634929-164634951 CCATCTAAGAAGACAGCAGAAGG + Intergenic
965144281 3:164879354-164879376 CCTGCTAGCCAAGCTGCAGATGG + Intergenic
965597525 3:170423141-170423163 CCTGGGAACAAGAGAGCAGATGG - Exonic
965894186 3:173553855-173553877 CCTGCATATCAGCCAGCAGAGGG - Intronic
967943731 3:194786158-194786180 TCTCCTCACCAGAGAGCAGAGGG + Intergenic
967952978 3:194854941-194854963 TCTGTCAACCAGACAGGAGATGG - Intergenic
969163515 4:5282654-5282676 CCTACTAATGAGACAGAAGAAGG + Intronic
970367023 4:15370347-15370369 CCTGCAAACCATACATCAGCTGG + Intronic
970603735 4:17660287-17660309 CCTGCTAAACAGATATCAGGTGG - Intronic
976348097 4:84028499-84028521 GCTACTAACCAGACAGCAGAAGG + Intergenic
977310671 4:95383024-95383046 CCTGCTAACAATACAGTAAATGG - Intronic
978342531 4:107733799-107733821 CCTGCAAACCAAACAGCAAACGG - Intergenic
984129269 4:175852764-175852786 CCTGTTTCCCTGACAGCAGATGG - Intronic
984379830 4:178978413-178978435 CCTGCTAGTCATACAGCAGGGGG + Intergenic
988485878 5:31667754-31667776 CCTGCTCACCAGAAGGCAGGAGG + Intronic
991196215 5:63935454-63935476 CCTGCTAAAGCCACAGCAGAAGG + Intergenic
991237354 5:64415228-64415250 CCTTCTGACAAGACATCAGAAGG + Intergenic
994250954 5:97536526-97536548 CCAACTAACCAAAGAGCAGAAGG + Intergenic
995250966 5:109992712-109992734 CTTGCTAAGCAGAAAGCAGTCGG + Intergenic
995648753 5:114343845-114343867 CCTGCCCATCAGACATCAGAGGG - Intergenic
996551688 5:124737117-124737139 TATGCTAACCAGAGAGCAGATGG - Intronic
996747923 5:126861607-126861629 ACTGCTAACTAGACAGCAGTGGG + Intergenic
997840823 5:137237678-137237700 CCTACAATTCAGACAGCAGAAGG + Intronic
998376353 5:141693455-141693477 ACAGCTAACCAGCCAGCTGAAGG + Intergenic
998393672 5:141804492-141804514 CCTCCTGACCAGTCAGCAGAGGG + Intergenic
999624176 5:153502644-153502666 CCTGCTGTCCAGAAAGCACAGGG + Intronic
999894522 5:156015558-156015580 CCTGTTTACCAGACAGAAAAAGG + Intronic
1000561524 5:162795225-162795247 CCTTCTAAACAGAAAACAGAAGG - Intergenic
1001946576 5:175783816-175783838 CCTGAGAACCAGAAAGCTGATGG + Intergenic
1003133887 6:3418225-3418247 CCTGCCATCAAGACAGCAGCTGG - Intronic
1004460827 6:15834296-15834318 CCTGCTAACTGGCCAGCAGAGGG + Intergenic
1004634832 6:17456698-17456720 CTTGAGAACCAGACAGCAAAGGG - Intronic
1007119122 6:39365893-39365915 CTTGGTGAACAGACAGCAGAAGG + Intronic
1007460299 6:42013171-42013193 CTTGATAATCAGATAGCAGAGGG + Intronic
1010354147 6:74910748-74910770 CCTACTGAAAAGACAGCAGACGG - Intergenic
1010686829 6:78863179-78863201 ACTGTTAACCAGATAGCAAAGGG - Intergenic
1014136808 6:117898765-117898787 CCTCCTAACCTGACAGGAGGCGG - Intergenic
1017122376 6:151036761-151036783 CCTGCTAAACAGTCATCACATGG + Intronic
1019511431 7:1419561-1419583 CCTGCTTACCTCCCAGCAGAGGG - Intergenic
1020943392 7:14568887-14568909 CTTTGTAACTAGACAGCAGAAGG + Intronic
1027889394 7:83951150-83951172 ACTGCTAATCTGACAGGAGATGG + Intergenic
1029747173 7:102522582-102522604 CTTGGTCACCAGACCGCAGAGGG + Intergenic
1029765126 7:102621671-102621693 CTTGGTCACCAGACCGCAGAGGG + Intronic
1036121783 8:6025466-6025488 CCTGCCAACAAGACAATAGATGG - Intergenic
1037905657 8:22714665-22714687 TCTGATACCCAGACAGAAGAGGG + Intronic
1038919255 8:32064483-32064505 CCTCCTACCAAGACAGCTGAAGG - Intronic
1039163721 8:34652170-34652192 CCAGCAATCCAGACAGCATAAGG + Intergenic
1039475306 8:37836492-37836514 CCTGGCACCCAGAAAGCAGATGG + Intronic
1049353049 8:142174502-142174524 CCTGAGAAGCAGGCAGCAGAGGG - Intergenic
1051418427 9:16868021-16868043 CCTGCTAACTTGTCAGCAGCAGG - Intronic
1053923221 9:43021262-43021284 CCTGCTAAACAGAAAGCACCAGG + Intergenic
1056688045 9:88782919-88782941 CTTGCAGACCACACAGCAGAAGG - Intergenic
1057203449 9:93156303-93156325 CCTGACACCCAAACAGCAGATGG + Intergenic
1058895831 9:109399855-109399877 CCTGCCAACCACACTGGAGAAGG + Intronic
1060089517 9:120730810-120730832 CCTGCTAAGCAAACAGCAGGTGG + Intergenic
1061802475 9:133120130-133120152 GCTGCTGACTACACAGCAGAGGG - Intronic
1062003764 9:134229329-134229351 CATGCCAACCAGACAGCAGTAGG - Intergenic
1062103932 9:134742461-134742483 CCTGCTCACCAGTCACCTGAGGG - Intronic
1062421950 9:136486886-136486908 CCTGCCAAGCACACAGCATAGGG + Intergenic
1185828051 X:3271873-3271895 CCTGCTACCCAGAGAGAAAAGGG + Exonic
1186520976 X:10206614-10206636 CCTGCAAGTCAGACAGCAGGAGG - Intronic
1189381140 X:40503190-40503212 CTTCCTCACCAGACAGCAGAAGG + Intergenic
1192492833 X:71591214-71591236 TCAGCTCACCAGACAGCAGCCGG - Intronic
1196666189 X:118319274-118319296 CCAGCTAACCAGACACCACTTGG - Intergenic
1196928540 X:120658369-120658391 GCTGCTAACCAGAAATCAAAAGG + Intergenic
1197947424 X:131854748-131854770 TCTGCCAACCAAACAGAAGAGGG + Intergenic
1199731380 X:150636195-150636217 CATGGTAACCACACATCAGATGG - Intronic
1201411772 Y:13705433-13705455 CCTGCCAGCCAGACAGGCGATGG - Exonic
1202047669 Y:20750760-20750782 ACTGCTAATCTGACAGCAGGTGG - Intergenic