ID: 1124267157

View in Genome Browser
Species Human (GRCh38)
Location 15:28247046-28247068
Sequence CTCTTTCTGTATCATGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124267153_1124267157 -1 Left 1124267153 15:28247024-28247046 CCTGTTAACCCTTGTCCTTGCGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1124267157 15:28247046-28247068 CTCTTTCTGTATCATGTGACTGG 0: 1
1: 0
2: 0
3: 13
4: 230
1124267154_1124267157 -9 Left 1124267154 15:28247032-28247054 CCCTTGTCCTTGCGCTCTTTCTG 0: 1
1: 0
2: 0
3: 20
4: 234
Right 1124267157 15:28247046-28247068 CTCTTTCTGTATCATGTGACTGG 0: 1
1: 0
2: 0
3: 13
4: 230
1124267152_1124267157 24 Left 1124267152 15:28246999-28247021 CCATAATAATTTTCTCAAACAGA 0: 1
1: 0
2: 1
3: 33
4: 462
Right 1124267157 15:28247046-28247068 CTCTTTCTGTATCATGTGACTGG 0: 1
1: 0
2: 0
3: 13
4: 230
1124267151_1124267157 25 Left 1124267151 15:28246998-28247020 CCCATAATAATTTTCTCAAACAG 0: 1
1: 0
2: 5
3: 37
4: 397
Right 1124267157 15:28247046-28247068 CTCTTTCTGTATCATGTGACTGG 0: 1
1: 0
2: 0
3: 13
4: 230
1124267155_1124267157 -10 Left 1124267155 15:28247033-28247055 CCTTGTCCTTGCGCTCTTTCTGT 0: 1
1: 0
2: 1
3: 24
4: 263
Right 1124267157 15:28247046-28247068 CTCTTTCTGTATCATGTGACTGG 0: 1
1: 0
2: 0
3: 13
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124267157 Original CRISPR CTCTTTCTGTATCATGTGAC TGG Intronic
900280647 1:1865644-1865666 TTCTTGCTGTATCCTGTCACTGG - Intronic
902260509 1:15221499-15221521 CTCTTTGTGTCTCATGTCTCTGG + Intergenic
902263178 1:15242367-15242389 CTCTTTCTGTATAATGAGTTGGG + Intergenic
904752562 1:32750015-32750037 CGTTTTCTTTAGCATGTGACAGG - Intronic
906138077 1:43514478-43514500 CTCTTTCCGCATCATGACACAGG - Intergenic
907297977 1:53467649-53467671 CCCTTTCTTTATCAAGTGAGGGG + Intergenic
907763112 1:57381285-57381307 CTGTTTCTCTCTCATTTGACAGG - Intronic
907796240 1:57720683-57720705 CTATTTATGTACCATGTGACAGG - Intronic
908077031 1:60531360-60531382 CTCTTTCCTTATCAACTGACTGG - Intergenic
908924033 1:69231426-69231448 CTCTATGTTTATCATGTGATGGG + Intergenic
909742371 1:79045793-79045815 CTCCTTCTGTATCATTTAAAGGG + Intergenic
912806265 1:112759139-112759161 CTCTTTCTGTCTCCTGCAACTGG - Intergenic
913216235 1:116623165-116623187 CTCTTTCCAGATCAGGTGACAGG + Intronic
916480835 1:165212947-165212969 CTCTTTCTCTACCTGGTGACTGG + Intronic
924255870 1:242182421-242182443 CTCTATCTGTATCATGTCCAGGG + Intronic
1063334560 10:5199318-5199340 CGCTTTCTGTATCATTTAAAGGG - Intronic
1063843889 10:10103607-10103629 CTCTTTCTGCCTCATGTGTGTGG + Intergenic
1064000345 10:11658544-11658566 GTCTTTCTTTATCTTGAGACAGG - Intergenic
1064427082 10:15239103-15239125 CCCTTTCTTTATCCTGTAACTGG - Intronic
1068207764 10:53879144-53879166 CACTTTCTGCATCGTGTCACTGG + Intronic
1069427334 10:68300369-68300391 CCCTGTCTGTAGCATGTTACAGG - Intronic
1070377516 10:75848238-75848260 TTCATGCTGTAGCATGTGACAGG - Intronic
1072198861 10:93140781-93140803 CTCTTTCTTTATCAGTTGATTGG + Intergenic
1073239742 10:102049121-102049143 TTCTTTCAGTAGCATGGGACAGG + Intronic
1075976317 10:126698894-126698916 ATCTTTCTTTATCAGGTTACTGG - Intergenic
1077871203 11:6263020-6263042 CTCTGTGTGTAACATCTGACTGG - Intronic
1079987384 11:27213244-27213266 TTCTTTGTGGTTCATGTGACAGG - Intergenic
1080435383 11:32236248-32236270 TTCTTTCTGAACCATTTGACAGG - Intergenic
1082969907 11:59009269-59009291 TTCCTTCTGTGTCATGTGGCTGG - Intronic
1083212995 11:61200718-61200740 CTCTCTCTGTTTTATGAGACAGG - Intergenic
1083517576 11:63274627-63274649 TTCTTTCAGTCTTATGTGACAGG + Intronic
1085371434 11:76010273-76010295 TACTTTCTGCATCATGTGCCTGG - Intronic
1091227013 11:133963574-133963596 TTCTTCCTGTATCATATCACAGG - Intergenic
1091804984 12:3349443-3349465 CTCTTTCTGTTTTCTTTGACAGG - Intergenic
1092506270 12:9103717-9103739 TTCATGCTGTAGCATGTGACAGG + Intronic
1093499356 12:19794517-19794539 CTCTTTTTCTATAATGTCACTGG - Intergenic
1096312427 12:50532960-50532982 CTATTTCTGATTCATTTGACAGG + Intronic
1098574344 12:72024144-72024166 CACTTTTTGTATTATGTGATTGG - Intronic
1104404998 12:128509824-128509846 GCCTTTCTGTACCATGTCACAGG + Intronic
1105076160 13:16026644-16026666 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105076553 13:16034476-16034498 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105076754 13:16038395-16038417 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105076960 13:16042316-16042338 CTCTTTCTGTAGAATCTGAAGGG + Intergenic
1105077376 13:16050144-16050166 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105077583 13:16054056-16054078 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105077973 13:16061713-16061735 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105078171 13:16065630-16065652 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105078380 13:16069543-16069565 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105078576 13:16073291-16073313 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105078775 13:16077204-16077226 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105078966 13:16080946-16080968 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105079173 13:16084866-16084888 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105079372 13:16088608-16088630 CTCTTTCTGTAGAATCTGAAGGG + Intergenic
1105079572 13:16092355-16092377 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105079771 13:16096271-16096293 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105079970 13:16100015-16100037 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105080186 13:16103931-16103953 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105080392 13:16107848-16107870 CTCTTTCTGTAGAATCTGAAAGG + Intergenic
1105133954 13:16991073-16991095 CTCTTTCTGTAGTATGTGCAAGG + Intergenic
1105159916 13:17415105-17415127 CTCTTTTTGTAGCATGTGCAAGG + Intergenic
1107301495 13:38970880-38970902 ATCATTCTGAATAATGTGACAGG + Intronic
1107592627 13:41924351-41924373 CTGTTTCTGTTTCTTTTGACTGG - Intronic
1108010468 13:46002605-46002627 TTCTTGCTGTGGCATGTGACAGG - Intronic
1108860693 13:54854770-54854792 GTCTTACTGTTTCATGTGGCTGG - Intergenic
1109132822 13:58610640-58610662 CCCTTTCTGTATCATTTAAAGGG - Intergenic
1109469788 13:62790271-62790293 CTCTTTCTGCATTGTGTGTCGGG - Intergenic
1110461542 13:75750804-75750826 CGCTTTGTGTAGCAAGTGACTGG + Intronic
1112455689 13:99560619-99560641 CATTTTCTGTATCATATGTCTGG - Intronic
1113552024 13:111200009-111200031 CCCTTTCTGACTCATGTTACGGG + Intronic
1116275410 14:42826111-42826133 CTCTTTCAGTATCAGTTGAAAGG + Intergenic
1116553456 14:46272268-46272290 CTATTTCTTTAACATGTTACAGG - Intergenic
1117300340 14:54419614-54419636 CACTTTCTGTAGCAAGTAACTGG - Intronic
1119298076 14:73549465-73549487 CTTTTTCTGCAGAATGTGACAGG - Intronic
1119302365 14:73581649-73581671 CTTTTTCTGCAGAATGTGACAGG - Intergenic
1120163945 14:81174194-81174216 CTGTTTCTGGATCCAGTGACAGG + Intergenic
1121935447 14:98014228-98014250 CTCTTTCTTTCATATGTGACAGG + Intergenic
1122057436 14:99112414-99112436 CTACTTCTGAATCATTTGACAGG - Intergenic
1123226505 15:17040093-17040115 CTCTTTCTGTAGAATCTGAAGGG + Intergenic
1123695832 15:22878507-22878529 GTCTTTGTGTATAATGTGAGAGG - Intronic
1124267157 15:28247046-28247068 CTCTTTCTGTATCATGTGACTGG + Intronic
1125258560 15:37796062-37796084 CTGTGTCTGTATCATATGAGAGG - Intergenic
1128648473 15:69393895-69393917 CTCATTCTGTAGCATTTGAGAGG + Intronic
1130338808 15:82981174-82981196 CTCTTCCTGTCCCATTTGACAGG + Intronic
1132509045 16:327815-327837 GGCTTTCTGCATCATGTGCCTGG - Intronic
1139023246 16:62779773-62779795 CTCATTCTATATCTTTTGACTGG + Intergenic
1140805569 16:78529350-78529372 CTCTTACTGAATTATGTGGCTGG + Intronic
1141119407 16:81340326-81340348 TTATTTCTGACTCATGTGACTGG - Intronic
1143796996 17:9344999-9345021 CTCTTTCTCTCTCAGGAGACAGG + Intronic
1143968485 17:10774604-10774626 CTCTTTCTTTTTCTTGAGACAGG + Intergenic
1143975793 17:10828640-10828662 CTCTCTGTGTAACATGTGTCTGG - Intronic
1145504768 17:24029305-24029327 CTCTTTCTGTGTCATCTGCAAGG + Intergenic
1145525520 17:24330972-24330994 CTCTTTCTGTAGCATCTGCAAGG + Intergenic
1145632196 17:25883601-25883623 CTCTTTCTGTGTCATCTGCAAGG + Intergenic
1148320694 17:46749578-46749600 CACTTTCTGAATCATGTGGTTGG + Intronic
1149695311 17:58611769-58611791 CACTTTCTGTCTCATCTGACTGG - Intronic
1150199131 17:63335178-63335200 CTCTTTGTGGATCATATCACAGG - Intronic
1150221929 17:63500661-63500683 CTCTTCCTGTCTCAAGTGAGAGG - Intronic
1151220574 17:72609312-72609334 CTCTACTTGTATCATGTTACTGG - Intergenic
1154558007 18:15783482-15783504 CACTTTCTGTAGCATGTGGAAGG + Intergenic
1154913823 18:20695179-20695201 CACTTTCTGTAGCATGTGGAAGG + Intergenic
1156762285 18:40607388-40607410 CTCTTTCTATATATTGTGTCAGG + Intergenic
1157191192 18:45583170-45583192 CTCTTTCACTATCATTTAACAGG + Intronic
1157383587 18:47244208-47244230 CTCTCTCTGTCTCATTTGACAGG + Intronic
1157801244 18:50623100-50623122 CTCTTTGGGTATCATTTGTCAGG + Intronic
1158656009 18:59335114-59335136 CCCTTTCTTTCTTATGTGACGGG - Intronic
1159411798 18:68086164-68086186 CTCTTTCAGTAGAATGTGAGAGG + Intergenic
1162723517 19:12676178-12676200 CTGTGTCTGTCTCCTGTGACTGG - Intronic
1162747611 19:12807440-12807462 CAGTGGCTGTATCATGTGACAGG - Exonic
1165509096 19:36255912-36255934 CTCTGTCTGGGTCATGTGGCCGG + Intergenic
1165633830 19:37323738-37323760 CTCTTTCTTGATGATGTCACTGG + Intronic
926699160 2:15791098-15791120 CTCTTTCTGGAGAATGTGAAGGG - Intergenic
927051768 2:19337243-19337265 TTCTTTCTGCATGATGAGACTGG - Intergenic
928082130 2:28320800-28320822 CTCTGCCTTTATCATGTGCCTGG + Intronic
929303429 2:40332401-40332423 CTCTTTCTGCAACATGTGTGTGG + Intronic
931208098 2:60166928-60166950 CTCCATCTAAATCATGTGACTGG + Intergenic
933225401 2:79742963-79742985 CTCTTTCTCTATAAACTGACCGG + Intronic
933262022 2:80141534-80141556 CTCTTTCTGTAAGATGAGGCCGG - Intronic
933507051 2:83190545-83190567 CACATTCTGTAATATGTGACAGG + Intergenic
934184076 2:89655877-89655899 CTCTTTCCAGATCAGGTGACAGG - Intergenic
934294366 2:91730014-91730036 CTCTTTCCAGATCAGGTGACAGG - Intergenic
934974007 2:98787647-98787669 CTCATTCTGTATAATGCCACAGG - Intergenic
936454078 2:112657533-112657555 CTATTTATCTATCATGTCACTGG - Intronic
936550580 2:113435696-113435718 CTCTTTCTGTGTTTTGAGACAGG - Intergenic
937635865 2:124154559-124154581 CTCTTTGTCCATCATGTGGCAGG - Intronic
938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG + Intronic
941618514 2:167751226-167751248 CTTTCTCTGTATTATGTGTCAGG - Intergenic
945022871 2:205591747-205591769 CTCTTTTTATCTCATCTGACTGG - Intronic
946142098 2:217700188-217700210 CTTGTTCTGTATCTTGTGCCAGG - Intronic
1168905032 20:1396369-1396391 CTCTTTGTGTAACAGGAGACAGG + Intergenic
1171176919 20:23058395-23058417 CTCTTTCTGAAACATGTATCTGG + Intergenic
1171743623 20:28936263-28936285 CTCTTTCTGTAGAATCTGAAGGG - Intergenic
1174233164 20:49064194-49064216 CTTTTTCTCTATCATGAGCCAGG - Intronic
1176323808 21:5366062-5366084 CTCTTTCTGTAGAATCTGAAGGG + Intergenic
1176481571 21:7300067-7300089 CTCTTTCTGTAGAATCTGAAGGG + Intergenic
1176531849 21:7972571-7972593 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176532051 21:7976483-7976505 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176532252 21:7980394-7980416 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176532462 21:7984477-7984499 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176532673 21:7988561-7988583 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176532887 21:7992646-7992668 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176533108 21:7996894-7996916 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176533310 21:8000809-8000831 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176533510 21:8004724-8004746 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176533721 21:8008639-8008661 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176533927 21:8012550-8012572 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176534128 21:8016463-8016485 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176534330 21:8020379-8020401 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176534441 21:8022758-8022780 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176534989 21:8033151-8033173 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1176535188 21:8037064-8037086 CTCTTTCTGTAGAATCTGAAAGG - Intergenic
1178527428 21:33343099-33343121 CTCTTTCTGTATCACTCCACTGG + Intronic
1178838354 21:36117578-36117600 CTAATCCTGTATCATGTGACTGG + Intergenic
1180013051 21:45064086-45064108 TTCTTTCGGTATTTTGTGACGGG - Intergenic
1180817580 22:18801530-18801552 CTCTTTCCAGATCAGGTGACAGG + Intergenic
1180929628 22:19580032-19580054 CTCATTCGATGTCATGTGACGGG - Intergenic
1181134361 22:20753994-20754016 CTCTTTCTGCATCACGTAAGTGG + Intronic
1181203769 22:21235850-21235872 CTCTTTCCAGATCAGGTGACAGG + Intergenic
1183045674 22:35217616-35217638 GAATTTCTGTCTCATGTGACTGG + Intergenic
1184236023 22:43183468-43183490 CTCTTTCTGTGTAATGTGAGTGG - Intronic
1203223151 22_KI270731v1_random:59564-59586 CTCTTTCCAGATCAGGTGACAGG - Intergenic
949147164 3:715706-715728 CTCTTTCTCCATCATCTGAGGGG - Intergenic
949258821 3:2082262-2082284 GTCTTTCTTCCTCATGTGACTGG - Intergenic
949750932 3:7351927-7351949 CTCATTCTGTAGCTTGTGAATGG + Intronic
952992288 3:38842330-38842352 CTCCTTGTGTATCAAGGGACAGG + Intergenic
953325553 3:42009640-42009662 TTCTTTCTGTATCTATTGACGGG + Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
957154048 3:76524177-76524199 CTGTTTATGTTTCATTTGACTGG + Intronic
958521190 3:95188541-95188563 CTCTTTCTGTATATTCTGAAAGG + Intergenic
959269815 3:104192756-104192778 CACTTTCTGTATCATTTAAAGGG + Intergenic
960399173 3:117174808-117174830 CTCTTTCTTTACCATGGGATTGG - Intergenic
962801108 3:138891406-138891428 CTCATGTTGTAGCATGTGACAGG - Intergenic
963761141 3:149288240-149288262 CTCTTCCTTTATGATGTTACGGG + Intergenic
965057490 3:163741463-163741485 CACTTTCAGTATCATGTTACCGG - Intergenic
965747424 3:171939893-171939915 CTCTTTCTGCCTCATCTGAAGGG + Intergenic
966633416 3:182104882-182104904 CTTTCTCTGTATCATTTCACAGG - Intergenic
967646971 3:191936969-191936991 TTCTTTCTGTCTCAAGTAACAGG + Intergenic
967907099 3:194510446-194510468 CTTATTCTGTTTCATGTCACGGG - Intergenic
969034390 4:4241369-4241391 CTCTTGCTGAATCAGGTCACAGG - Intronic
971013207 4:22461599-22461621 CTCTTTCTGTATCAGGGACCTGG + Intronic
977526216 4:98148931-98148953 TGCATGCTGTATCATGTGACAGG - Intergenic
978382503 4:108144330-108144352 CTGTTTCTTTAGCATGTGCCTGG - Intronic
978504443 4:109441434-109441456 TTCTTTCTGTATTTTGAGACAGG + Intronic
980533425 4:134084602-134084624 CTTTTTCTGTAAGATGTAACTGG - Intergenic
981454740 4:144940395-144940417 CTCTTTCAGTGTAATGTGAGTGG - Intergenic
981464778 4:145055597-145055619 TTCATGTTGTATCATGTGACAGG - Intronic
984340548 4:178451150-178451172 ATTTATCTGTATCATGTGTCTGG - Intergenic
984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG + Intronic
985844564 5:2334706-2334728 TTCTTTCTGTATCATTTACCTGG + Intergenic
987543200 5:19281132-19281154 TTCTATCTGTGTCATGTGTCAGG + Intergenic
988044268 5:25929500-25929522 CTCTTTCTGTTTCAAGTGATTGG + Intergenic
989581264 5:43035340-43035362 CTTTTTGTGCATCATTTGACAGG + Intergenic
991343267 5:65635494-65635516 CTATTTTTGTATCATGTGAAAGG + Intronic
992163717 5:74027550-74027572 CTCTTTCTGTATCATTTTATAGG + Intergenic
1000224004 5:159240614-159240636 CTCTTTTTATATCATGTTACAGG - Intergenic
1002446130 5:179291165-179291187 CTCATTCTGTCTGATGTGAGTGG - Intronic
1002699295 5:181111188-181111210 CCCTTTCTGTAGCCTGGGACAGG + Intergenic
1002795487 6:467939-467961 CTCTCTCTGTATCAGGTAGCTGG - Intergenic
1004178829 6:13364067-13364089 CTCTTTCTCTACCAGGTGAAGGG + Exonic
1004288469 6:14344973-14344995 CTCTTTCTGAATTATGTAAATGG + Intergenic
1012523615 6:100150684-100150706 TGGTTTCTGTCTCATGTGACTGG + Intergenic
1013561511 6:111309710-111309732 CGCTTTCCGTATCATTTTACGGG + Intronic
1014202328 6:118620596-118620618 CTCTTGCTGAATCATCTGGCTGG - Intronic
1014351559 6:120352527-120352549 CTCTTTCTCTTTCTTGTTACTGG - Intergenic
1016749480 6:147617101-147617123 CTCTTTCTTTGTTATGTGAGGGG + Intronic
1017197755 6:151720165-151720187 CTTTTCCTTTATCATGTGTCTGG + Intronic
1018404222 6:163460494-163460516 CTCTTTCTGTTTCATTTTCCTGG + Intronic
1024206524 7:47166998-47167020 CTTTTTCTGTATCAATTGATAGG - Intergenic
1028192816 7:87872471-87872493 TTCTTCCTCTATCATCTGACTGG - Intronic
1029922935 7:104285543-104285565 CTCTCTCTTTTTAATGTGACTGG + Intergenic
1030159470 7:106492718-106492740 CTCTCTCTCTCTCATGAGACGGG + Intergenic
1030877514 7:114833681-114833703 CTCTTTCTTTTTCTTTTGACAGG + Intergenic
1032518101 7:132521892-132521914 CTCTTCCTTTTTCAGGTGACAGG + Intronic
1033074972 7:138240582-138240604 CTATTTCTATTTCATGTGATGGG + Intergenic
1033947531 7:146740445-146740467 CTATTTCTGTATGATGTCACTGG + Intronic
1034276116 7:149824567-149824589 CTCTGTCTGGATCCTGCGACAGG + Intergenic
1036187919 8:6640837-6640859 CACTTACTGTATAATGTGAGGGG + Intronic
1036784028 8:11673610-11673632 CTCTTTATGTAGCAGGTAACTGG - Intergenic
1037395112 8:18433384-18433406 CTCTTTCTGAATCCTTTAACTGG - Intergenic
1038112893 8:24519218-24519240 CTCTTTCTTTTTCACGTTACTGG - Intronic
1042087779 8:65127715-65127737 CACTTTGTGTCTCTTGTGACAGG - Intergenic
1044471307 8:92571958-92571980 CTCTTTCTGCATCTTATGACAGG + Intergenic
1045095884 8:98798088-98798110 CTATTGCTGTATCATGTGGATGG - Intronic
1045485061 8:102624495-102624517 CTTTTTCTGTTTCCTGTGAATGG + Intergenic
1047713662 8:127576088-127576110 CTCTCTCAGTATCATGAGAATGG - Intergenic
1049902355 9:181127-181149 CTCTTTCTGTTTTTTGAGACAGG + Intergenic
1050704106 9:8376339-8376361 CTCTTCCTGTAAAATGTGATAGG - Intronic
1052399075 9:27978029-27978051 CTCTTGCTGAATGATGTCACTGG + Intronic
1053745383 9:41191416-41191438 CTCTTTCTGTTTTTTGAGACAGG + Intronic
1054481890 9:65673797-65673819 CTCTTTCTGTTTTTTGAGACAGG - Intronic
1054682963 9:68239856-68239878 CTCTTTCTGTTTTTTGAGACAGG - Intronic
1057413508 9:94840230-94840252 CTTTTTCTGTATTAATTGACAGG + Intronic
1059288528 9:113199818-113199840 CTCTTTCAGAATCATGTGCTGGG - Exonic
1060670207 9:125462080-125462102 CTCTCTCTTTCTCATGTGATAGG - Intronic
1061523705 9:131139473-131139495 CTCTGTCAGTAACATGTAACTGG - Intronic
1202781512 9_KI270718v1_random:2196-2218 CTCTTTCTGTTTTTTGAGACAGG + Intergenic
1203385070 Un_KI270438v1:30112-30134 CTCTTTCTGTAGAATCTGAAGGG + Intergenic
1186831554 X:13395444-13395466 ATCTTTCTATATCATTAGACAGG + Intergenic
1190870159 X:54418130-54418152 CTATTTCTGTCTCATGAGTCAGG - Intergenic
1194859288 X:98976231-98976253 CTTTTTCTGTATCTTTTGATAGG - Intergenic
1195678629 X:107526578-107526600 CTCTTCCTGCATCACATGACTGG - Exonic
1196035761 X:111142493-111142515 CTTTTTCTTTATCAAGTGAATGG + Intronic
1198535939 X:137586371-137586393 CTCTTTCATTATTATGTAACTGG - Intergenic
1199954359 X:152731788-152731810 CTTTTTCTGTACCCTTTGACAGG - Intronic
1201693839 Y:16800955-16800977 CTCTCTCTGAATCATATCACTGG + Intergenic