ID: 1124267296

View in Genome Browser
Species Human (GRCh38)
Location 15:28248183-28248205
Sequence TGTCACATGGGGGAGCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124267296 Original CRISPR TGTCACATGGGGGAGCCAGC TGG (reversed) Intronic
900562049 1:3312074-3312096 TGTCGCATGGGGGAGCAGCCGGG - Intronic
901206988 1:7503097-7503119 TGTGGAATGGGGGAGCCTGCTGG + Intronic
902830683 1:19010415-19010437 TGTCTGATGGGTCAGCCAGCGGG + Intergenic
902927111 1:19703385-19703407 TGCCACAAGGGGGAGGCAGGGGG - Intronic
904923907 1:34030796-34030818 TGACACATGGGGGAACTGGCCGG - Intronic
905886227 1:41493544-41493566 TGCCAGATTGGGGAGGCAGCTGG + Intergenic
906707962 1:47908736-47908758 TGTCCCATCTGGGAGGCAGCAGG + Intronic
909376630 1:74949227-74949249 TGTCATAGGAGGGACCCAGCGGG + Intergenic
912267720 1:108175192-108175214 TGTCACAGGAGGGACCCAGTGGG + Intronic
916148834 1:161766355-161766377 TGTGAAATGGGGGAGCCGGCTGG + Exonic
916355373 1:163900034-163900056 TGGCTCATGGGCCAGCCAGCAGG + Intergenic
916560202 1:165928548-165928570 CATGACATGGGGGAGGCAGCAGG - Intergenic
917586373 1:176431090-176431112 TGTCACAGGAGGGACCCAGTTGG - Intergenic
918908067 1:190525518-190525540 TGTCAGATGGAGGAAGCAGCTGG - Intergenic
919979569 1:202633977-202633999 TCTCACATGTGGGAGCAAGGTGG + Intronic
920340312 1:205271554-205271576 TGCCTCAAGAGGGAGCCAGCTGG + Intronic
920739572 1:208567747-208567769 TGTGACATGTGGGAGCCAGAAGG - Intergenic
921027890 1:211305184-211305206 TGTCACAGGAGGGTGCCAGCAGG + Intronic
921771988 1:219051181-219051203 TGTCACATGGTGGAGTAAGTGGG - Intergenic
922653136 1:227358142-227358164 TGTCATATTGGGGATTCAGCAGG - Intergenic
922740803 1:228013355-228013377 TGTCACCTGGGGAGGCCAGTAGG - Intronic
923456459 1:234169477-234169499 TGTCACAACGGGCAGCCAGAGGG + Intronic
1063954745 10:11255640-11255662 TGTCACAGTGGGGAGAGAGCTGG + Intronic
1064607930 10:17063413-17063435 TATCACACAGGGAAGCCAGCTGG + Intronic
1066421374 10:35267636-35267658 TGTCACAAGAGGGAGCAACCAGG - Intronic
1067077557 10:43196863-43196885 TGTGGCATGGAGCAGCCAGCAGG + Intronic
1070168834 10:73917237-73917259 TGTCACGTGGGGGACCCAAGAGG - Exonic
1070757973 10:79005293-79005315 GGTCACAGGGTGCAGCCAGCAGG + Intergenic
1072000837 10:91194196-91194218 TGTCACTTTAGGGAGCCAGAGGG + Intronic
1073452627 10:103618755-103618777 TGTCACAGCTGGGAGCCAGGAGG - Intronic
1074044120 10:109820854-109820876 TGGCTCATGGAGGAGCCAGAAGG - Intergenic
1076979804 11:198359-198381 TGTGACATGGGGCAGCCCGACGG + Intronic
1077020565 11:415490-415512 AGACACATGGGGGAGCAAACCGG - Intronic
1082229312 11:49744467-49744489 TGTCACAGGAGGGACCCAGTGGG - Intergenic
1083536139 11:63468351-63468373 TCTTACTTGGGGGAGCCAGATGG + Exonic
1087425451 11:97980060-97980082 TGGCAGATGGGGGAGCTAGAAGG + Intergenic
1088103236 11:106177231-106177253 TAGCAGATGGGGGAGCCAGAAGG - Intergenic
1089356910 11:117859964-117859986 TCTCACACAGGGGAGCAAGCAGG - Intronic
1091300161 11:134502478-134502500 TGACACATGGGGGAGAGAGAGGG - Intergenic
1095204771 12:39427018-39427040 TGTTTCATGGGAGAGCCATCAGG + Intronic
1096109479 12:49020513-49020535 TGGGGCATGGGGGAGCCGGCTGG - Exonic
1096171669 12:49476353-49476375 CGGCAGATGGGGGAGCCAGAAGG - Intronic
1097908965 12:64948908-64948930 TGTCACATTGGGCAGGCAGTGGG + Intergenic
1101452055 12:104788914-104788936 GGTCACATGGGGAAGCCACATGG + Intergenic
1102029115 12:109729950-109729972 TAGCACGTAGGGGAGCCAGCTGG + Intronic
1102595614 12:113990625-113990647 TGGGTCAGGGGGGAGCCAGCTGG - Intergenic
1104591446 12:130087374-130087396 TGCCACATTGAGCAGCCAGCTGG - Intergenic
1105439409 13:20402899-20402921 GGGCACATGGGGCAGGCAGCTGG + Intergenic
1105710383 13:23002421-23002443 TGTAACTTGGGTTAGCCAGCAGG + Intergenic
1106086471 13:26546796-26546818 GGTCACACGCTGGAGCCAGCGGG - Intergenic
1106182963 13:27383886-27383908 CGTCAAACGGGGGAGCCAGAAGG - Intergenic
1106394063 13:29363190-29363212 TGTTTCATGGGAGAGCCACCAGG - Intronic
1107978898 13:45715571-45715593 TGTCACAGCTGGGAGCCAGGTGG - Intergenic
1107984187 13:45760896-45760918 TGTCCCATGGGGGTGTCAGAGGG - Intergenic
1109151700 13:58856585-58856607 CAGCACATGGGGGAGCCAGAAGG + Intergenic
1109286983 13:60421414-60421436 TGTCACAGGAGGGACCCAGTGGG - Intronic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1110852783 13:80263483-80263505 GGTTACATGGGGGAGCATGCTGG - Intergenic
1111818374 13:93183497-93183519 TGTTACAAGGGGGAGGCAGGGGG - Intergenic
1112329999 13:98469784-98469806 TGTCTGGTGGGAGAGCCAGCAGG - Intronic
1112394755 13:99019488-99019510 TGTCATAAGAGGGAGCCACCTGG - Intronic
1112575301 13:100629944-100629966 TGTCACATCAGGGTGTCAGCAGG - Intronic
1114643092 14:24237703-24237725 TATCATCTGGGGCAGCCAGCAGG + Intronic
1118911359 14:70064656-70064678 AGTCACAGGGATGAGCCAGCTGG + Intronic
1119697664 14:76726523-76726545 TAGCAGATGGGGGAGCCAGAAGG + Intergenic
1120206145 14:81589578-81589600 TGTCACTGGGTGGAGCCTGCTGG + Intergenic
1121791339 14:96701866-96701888 GGTCAAGTGGGGGAGCCAGAAGG - Intergenic
1123103152 14:105819173-105819195 TGTCACAGGAGGGAGGCAGAGGG - Intergenic
1123937461 15:25200903-25200925 GGTCGTGTGGGGGAGCCAGCAGG + Intergenic
1124267296 15:28248183-28248205 TGTCACATGGGGGAGCCAGCTGG - Intronic
1124495179 15:30181987-30182009 TCTCACATGTGGGAGCAAGTTGG + Intergenic
1124864119 15:33472487-33472509 AGTGACCTGGGGGAGCCAGCTGG - Intronic
1127627425 15:60793993-60794015 TGTCACCTTGGAGAGCCAGCTGG - Intronic
1129105498 15:73304587-73304609 GGTCACATGGGGGTGCCAGGCGG + Exonic
1133517674 16:6525608-6525630 TGTCACATGAAGGCACCAGCAGG + Intronic
1134053842 16:11156819-11156841 TGGCACATGGGGGACACAGGTGG - Intronic
1134165487 16:11926168-11926190 TGTCACATGGGCAGGACAGCAGG - Intergenic
1134242650 16:12517351-12517373 TGTCACATGGGGCTCCCAGGAGG - Intronic
1134489821 16:14688279-14688301 TGTCACATGGGCAGGACAGCAGG + Intronic
1134495201 16:14727396-14727418 TGTCACATGGGCAGGACAGCAGG + Intronic
1134500587 16:14766516-14766538 TGTCACATGGGCAGGACAGCAGG + Intronic
1134527127 16:14953129-14953151 TGTCACATGGGCAGGACAGCAGG + Intergenic
1134545276 16:15103219-15103241 TGTCACATGGGCAGGACAGCAGG - Intronic
1134579996 16:15362534-15362556 TGTCACATGGGCAGGACAGCAGG - Intergenic
1134714712 16:16351662-16351684 TGTCACATGGGCAGGACAGCAGG + Intergenic
1134722589 16:16395026-16395048 TGTCACATGGGCAGGACAGCAGG + Intergenic
1134944839 16:18316843-18316865 TGTCACATGGGCAGGACAGCAGG - Intergenic
1134952103 16:18356996-18357018 TGTCACATGGGCAGGACAGCAGG - Intergenic
1135363392 16:21833486-21833508 TGTCACATGGGCAGGACAGCAGG - Intergenic
1135448400 16:22537592-22537614 TGTCACATGGGCAGGACAGCAGG + Intergenic
1136150027 16:28341407-28341429 TGTCACATGGGCAGGACAGCAGG - Intergenic
1136166262 16:28455222-28455244 TGTCACATGGGCAGGACAGCAGG - Intergenic
1136196710 16:28659810-28659832 TGTCACATGGGCAGGACAGCAGG + Intergenic
1136213050 16:28773935-28773957 TGTCACATGGGCAGGACAGCAGG + Intergenic
1136257777 16:29053848-29053870 TGTCACATGGGCAGGACAGCAGG + Intergenic
1136307191 16:29380212-29380234 TGTCACATGGGCAGGACAGCAGG - Intergenic
1136435289 16:30221795-30221817 TGTCACATGGGCAGGACAGCAGG - Intergenic
1136778430 16:32883508-32883530 TTTCTCAAGTGGGAGCCAGCTGG + Intergenic
1136892190 16:33978006-33978028 TTTCTCAAGTGGGAGCCAGCTGG - Intergenic
1139855319 16:69975208-69975230 TGTCACATGGGCAGGACAGCAGG - Intergenic
1139885036 16:70202323-70202345 TGTCACATGGGCAGGACAGCAGG - Intergenic
1140367479 16:74393190-74393212 TGTCACATGGGCAGGACAGCAGG + Intergenic
1142291326 16:89194815-89194837 AGACACATGGAGGGGCCAGCGGG - Intronic
1203080852 16_KI270728v1_random:1145617-1145639 TTTCTCAAGTGGGAGCCAGCTGG + Intergenic
1143335816 17:6170806-6170828 CATCACATGGGGCAGCCGGCTGG - Intergenic
1143358506 17:6348940-6348962 TTTCTCATGGAGGAGTCAGCTGG - Intergenic
1143865324 17:9918941-9918963 TGACACCTGGGGAAGGCAGCTGG + Intronic
1151887073 17:76929299-76929321 TGTCCCAGGGTGGAGCCCGCTGG + Intronic
1152280112 17:79380151-79380173 TGTTAGGTGGGGGAGCCAGACGG - Intronic
1153806676 18:8714689-8714711 TGTCACAGGAGGGACCCAGTGGG - Intronic
1155703497 18:28778992-28779014 TAGCAGATGGGGGAGCCAGAAGG - Intergenic
1157981839 18:52390634-52390656 TGTCACATGGTGGAGTTCGCAGG + Intronic
1158345113 18:56508472-56508494 TGTCACAGGAGGGACCCAGTGGG + Intergenic
1158434819 18:57428297-57428319 TGTCAAATTGGGGAGCCAGTGGG + Intergenic
1158487431 18:57879972-57879994 TGTCACAGGAGGGACCCAGTGGG + Intergenic
1158669747 18:59464093-59464115 TGTCCCATGGTGGAGACAGTGGG - Intronic
1161162698 19:2769791-2769813 TGTCAGGTGGGGGAACCAGGCGG - Intronic
1162046301 19:8002555-8002577 TGCCACCTAGGGGCGCCAGCCGG + Intronic
1163686892 19:18716861-18716883 TGGGACATGGGGGAGCCAGGTGG + Intronic
1163897690 19:20073992-20074014 TGTCCCCTGGGGGAGCCCTCTGG - Intergenic
1166703668 19:44896515-44896537 TGTGAAATGGGGGTGCCTGCGGG - Intronic
1167441275 19:49510586-49510608 AGTCTAATGGGGGAGCCAGCAGG - Intronic
925117651 2:1394023-1394045 TGTCACATGGAGGAGATAGGTGG - Intronic
925403035 2:3589286-3589308 TGTGAAATGGTGCAGCCAGCTGG - Intergenic
927869793 2:26616227-26616249 GGCCACATGGGGCAGCCAGCTGG + Intronic
934957065 2:98631681-98631703 CAGCACATGGGGGAGCCAGAAGG - Intronic
935516470 2:104046713-104046735 AGACACAGGGGAGAGCCAGCTGG + Intergenic
937161472 2:119766406-119766428 AGTGAAATGGGGGAGGCAGCGGG - Intronic
937275350 2:120680442-120680464 TGTGACATTGGGGCGCCACCTGG + Intergenic
940303340 2:152198886-152198908 AGCCACATGGGGAAGCCACCAGG - Intergenic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
941106838 2:161364073-161364095 TAGCAGATGGGGGAGCCAGAAGG + Intronic
943067547 2:183105063-183105085 TGTCGCATGAGGGACCCAGTGGG - Intergenic
946146463 2:217734910-217734932 TGTCACAAGAGGGACCCAGTAGG - Intronic
948588487 2:239035593-239035615 TGGCCCACGGGGGAGCCCGCAGG - Intergenic
1168857254 20:1017326-1017348 AGACACATGGTGGAGTCAGCAGG - Intergenic
1176071810 20:63230874-63230896 CGGCAGATGGGGGAGCCAGAAGG + Intergenic
1177920614 21:27147905-27147927 TGTCATAGGGGGGAACCAGTAGG + Intergenic
1179623201 21:42632391-42632413 TGAGACATGGGGCAGCCACCGGG - Intergenic
1180910957 22:19449522-19449544 TGGCTCATGGGGGACCCTGCTGG + Intergenic
1181579710 22:23821230-23821252 TGTCACAGGGTGGACACAGCTGG + Intronic
1182464377 22:30505472-30505494 TGTACCATGGGGGCTCCAGCCGG + Intronic
1183678399 22:39312625-39312647 TGTCACCAGGGTGAGGCAGCTGG - Intergenic
1185358919 22:50393440-50393462 TGACACATGGGAGAGACACCTGG + Intronic
1185366815 22:50440606-50440628 TGTATCATGGGGGAGGCAACAGG + Intronic
949867418 3:8557847-8557869 TGTCACTTGGAGGAGCTTGCAGG + Intronic
952168925 3:30783740-30783762 TTTCATCTGTGGGAGCCAGCTGG - Intronic
953666673 3:44930593-44930615 ATTCCCGTGGGGGAGCCAGCAGG - Intronic
954539116 3:51382149-51382171 AGTCACATGCCTGAGCCAGCAGG - Exonic
954997417 3:54894359-54894381 TGGCACCTAGGGCAGCCAGCAGG - Intronic
956201061 3:66706341-66706363 TGTCATGGGGGGGACCCAGCTGG - Intergenic
958928836 3:100187744-100187766 TGCCACATGGTGGAGCCTGGTGG - Intronic
961403803 3:126665271-126665293 TGTCAGATGGTGGACCCAGAGGG - Intergenic
961477671 3:127158792-127158814 AGTGACAAGGAGGAGCCAGCAGG + Intergenic
962463970 3:135639677-135639699 TGGCCCATGGGGGCACCAGCAGG - Intergenic
964549138 3:157867490-157867512 TGTCACATCAGGAAACCAGCAGG + Intergenic
966486298 3:180474789-180474811 TGTCACAGGAGGGACCCAGTGGG - Intergenic
966832083 3:184018152-184018174 TGTTCCCTGGGGGAGGCAGCCGG + Intergenic
967991175 3:195132007-195132029 TGAGACTTGGGGGAGCCAGGCGG + Intronic
971859377 4:32085473-32085495 TGTCATGTGGGGCAGCCAACTGG + Intergenic
971868665 4:32207059-32207081 TGTCACAGGAGGGACCCAGTGGG - Intergenic
973849017 4:54942830-54942852 TTTCACTTGTGGGAGCCAGTGGG + Intergenic
974974993 4:68880872-68880894 CAGCAGATGGGGGAGCCAGCAGG + Intergenic
976726869 4:88223361-88223383 TGTCACAGGAGGGACCCAGTGGG + Intronic
977088551 4:92637729-92637751 TGTCACAGTTGGAAGCCAGCTGG - Intronic
978289113 4:107116568-107116590 TGTCACGGGGGGGACCCAGTGGG + Intronic
979233633 4:118374966-118374988 TGTCACAGGAGGGACCCAGTGGG + Intergenic
984881004 4:184409969-184409991 TGTGACCTGGGTGAGTCAGCAGG + Intronic
984943349 4:184952799-184952821 TGTCTCCTGGAGGAGCCACCAGG + Intergenic
986200651 5:5575392-5575414 TGTCACATGGGGTGGGGAGCAGG - Intergenic
986631787 5:9781330-9781352 TGTGAGATGTCGGAGCCAGCAGG - Intergenic
992015610 5:72572574-72572596 AGACACATGTGGGAGCAAGCTGG - Intergenic
997811738 5:136977314-136977336 TGTCACTTGGGGGAGTGAGGGGG + Exonic
998398469 5:141834968-141834990 TGCCACATGGAAGAGTCAGCGGG - Intergenic
998753833 5:145353744-145353766 TGTCACAGGAGGGACCCAGTGGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999692364 5:154159139-154159161 TGTGACATGGGAGAGCCAGGAGG - Intronic
1001454554 5:171850727-171850749 TGTCACAATGGGGAGGCAGGAGG + Intergenic
1002271348 5:178074540-178074562 TCTCAGATGGGGGAGCCAGAAGG - Intergenic
1003009466 6:2413145-2413167 GGTCACTTTGGGAAGCCAGCTGG + Intergenic
1003164312 6:3663097-3663119 TGTCATCTGGGGGAGCCATCTGG + Intergenic
1003499781 6:6694831-6694853 TCTCAGATGGGGGAGCCAGAAGG + Intergenic
1006451435 6:34107881-34107903 TGTCACAAGGAGGAGACACCTGG - Intronic
1006502300 6:34466495-34466517 GGTCCCTTGGGGGAGCGAGCTGG + Intronic
1006799744 6:36752345-36752367 AGACAGATGGGGGAGCCAGGAGG - Intronic
1006927361 6:37664453-37664475 TGTCACCTTGGGGAGCCAGGAGG - Intronic
1010583251 6:77625865-77625887 TGTCATCTAGGGCAGCCAGCTGG - Intergenic
1010788333 6:80031711-80031733 TGTCACATGTGAGGGGCAGCGGG - Intronic
1010871684 6:81049896-81049918 TGTAACAAGGGGGAATCAGCTGG - Intergenic
1014670601 6:124300169-124300191 TGTCAAGTGGGGGGGCCAGGTGG + Intronic
1017582672 6:155883539-155883561 TGTCACTTGGGTGACCCTGCTGG - Intergenic
1017800723 6:157893462-157893484 CGACACATGGGGCAGACAGCTGG - Intronic
1017927872 6:158925864-158925886 TGTCATAGGAGGGACCCAGCGGG + Intergenic
1019205835 6:170360871-170360893 TTTCACAGGAGGGAGCCAGCAGG - Intronic
1019269010 7:135492-135514 TGTCACTTGGGGCATCCAGGTGG - Intergenic
1019438188 7:1032461-1032483 TGTCACCTGGGGGTGCCTGGCGG - Intronic
1019438206 7:1032517-1032539 TGTCACCTGGGGGTGCCTGGCGG - Intronic
1019438224 7:1032573-1032595 TGTCACCTGGGGGTGCCTGGCGG - Intronic
1019438242 7:1032629-1032651 TGTCACCTGGGGGTGCCTGGAGG - Intronic
1019441018 7:1046862-1046884 TTTCCCAGGGAGGAGCCAGCAGG - Intronic
1022044231 7:26610631-26610653 AGCCACATGTAGGAGCCAGCTGG + Intergenic
1022527574 7:31048490-31048512 TGTCTCATAGAGGAGCCAGGAGG - Intergenic
1022954254 7:35366789-35366811 TTGCAAATGGGGGAGCCAGGGGG + Intergenic
1023253541 7:38290694-38290716 TAGCAGATGGGGGAGCCAGACGG - Intergenic
1025038413 7:55618143-55618165 TGTCACAGGAGGGACCCAGTGGG + Intergenic
1028611651 7:92718545-92718567 TGTCACTTGGTGGTGCCAACTGG + Intronic
1029616660 7:101663456-101663478 TGTCACAGGAGGGACCCAGTGGG + Intergenic
1032794109 7:135263782-135263804 TGTCATGTGGGGCAGCCATCCGG + Intergenic
1035375872 7:158406456-158406478 TGTCTCATGGATGAGCCACCGGG - Intronic
1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG + Intergenic
1037546414 8:19928442-19928464 TGTCAAATGGGGGAGAAAGCAGG - Intronic
1041393571 8:57369037-57369059 TGTCTGATCTGGGAGCCAGCTGG - Intergenic
1043287947 8:78558629-78558651 TGTCACAGGAGGGACCCAGGTGG - Intronic
1045277358 8:100720859-100720881 AGTCGCCTGGGGGAGCCACCAGG - Intronic
1048082972 8:131148867-131148889 TAGCAGATGGGGGAGCCAGAAGG + Intergenic
1048455453 8:134574150-134574172 TGGTAGGTGGGGGAGCCAGCAGG + Intronic
1048528341 8:135225105-135225127 TGGCAAATGGGGGAGCCAGGTGG - Intergenic
1048922672 8:139245456-139245478 TGTCACATGGTGAAGGCAGGAGG + Intergenic
1049226231 8:141451839-141451861 GGTGACATGGGGAAGCCTGCAGG + Intergenic
1049562952 8:143321163-143321185 TGTCACATAGCGGGGGCAGCTGG + Intronic
1050342483 9:4654636-4654658 CAGCAGATGGGGGAGCCAGCAGG + Intronic
1050940645 9:11452710-11452732 TGTCATGGGGGGGACCCAGCGGG + Intergenic
1051898097 9:22009297-22009319 TGGCAGAGTGGGGAGCCAGCCGG + Exonic
1055769856 9:79705386-79705408 AGTGAGATGGGGGAGCAAGCTGG + Intronic
1056581182 9:87888846-87888868 TGTCTCCTGGGGGAGACAGGGGG + Exonic
1056662704 9:88556248-88556270 TGTCACATGGGGAGGCCACCTGG + Intronic
1057268440 9:93633842-93633864 TGCCACGGAGGGGAGCCAGCAGG - Intronic
1057294334 9:93826678-93826700 GGTCACATGTGGGAGTCATCAGG + Intergenic
1058399317 9:104595347-104595369 GGCCACATGGGGAAGCCACCAGG - Intergenic
1060786203 9:126453292-126453314 TGTCAACTGGGTGAGCAAGCAGG + Intronic
1060886662 9:127159320-127159342 TTTCACCTTGGGGAGCCAGGAGG + Intronic
1061583789 9:131554047-131554069 AGTAACATGGTGGAGCCAGGAGG - Intergenic
1062266380 9:135688262-135688284 GGTCCCAGGGAGGAGCCAGCAGG + Intergenic
1062276978 9:135735892-135735914 TGTCACCTGGGCGAGTCACCTGG + Intronic
1192195383 X:69024384-69024406 AGTCACGTGGCAGAGCCAGCAGG + Intergenic
1192805585 X:74505790-74505812 TGTCCCATTGGGGTGCCTGCTGG + Intronic
1194298292 X:92154810-92154832 GGGCAGATGGGGGAGCCAGAAGG - Intronic
1199822391 X:151462410-151462432 AGTGACCAGGGGGAGCCAGCTGG - Intergenic
1200101399 X:153690548-153690570 TTTCTCAAGTGGGAGCCAGCTGG - Intronic
1200615900 Y:5379770-5379792 GGGCAGATGGGGGAGCCAGAAGG - Intronic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic