ID: 1124267544

View in Genome Browser
Species Human (GRCh38)
Location 15:28250307-28250329
Sequence TGGTGGTGGTGAGCCCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124267544_1124267549 10 Left 1124267544 15:28250307-28250329 CCTCACTGGGCTCACCACCACCA 0: 1
1: 0
2: 6
3: 42
4: 325
Right 1124267549 15:28250340-28250362 TCACTACCTGATACCCTGCCTGG 0: 1
1: 6
2: 0
3: 12
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124267544 Original CRISPR TGGTGGTGGTGAGCCCAGTG AGG (reversed) Intronic
900785311 1:4645937-4645959 TGGTGGTGGTGAGGAGAGGGAGG - Intergenic
901275805 1:7990145-7990167 TGGTGGTGGTGACAACAGTGGGG - Intergenic
901437198 1:9254575-9254597 TGGTGGTAGTGAAATCAGTGAGG - Intronic
901499681 1:9644088-9644110 TGGTGGTGGTGAAGCCACTCCGG + Intergenic
902526398 1:17060730-17060752 TGGTAGTGGAGAGCCCAGCTGGG + Intergenic
902674443 1:17999082-17999104 TGCTGTGGGTGAGCACAGTGTGG + Intergenic
903021928 1:20400721-20400743 GGGGGGTGGTGAGCCCAGAGAGG + Intergenic
903478156 1:23634649-23634671 GGGTGCTTGTGAGGCCAGTGTGG + Intronic
903665739 1:25006418-25006440 TTGTGCAGGTGAGCCCAGGGAGG + Intergenic
905337237 1:37253461-37253483 GGGTGGTGGTGGGGTCAGTGGGG - Intergenic
905403118 1:37717198-37717220 TGGTTGTGCTGAGCCCACCGTGG - Exonic
906128349 1:43441390-43441412 TGGTGGTGGTGTGCCCTGGGAGG + Intronic
906140917 1:43532856-43532878 TGGAGGGGGTGAGCTGAGTGTGG - Intronic
906244266 1:44262178-44262200 GGGTGGGGCTGGGCCCAGTGGGG - Intronic
906434926 1:45787348-45787370 TGGTGGTAGAGAGGCTAGTGGGG - Intronic
909480069 1:76121284-76121306 TGGTGGTGGAGATCCCAGCAGGG - Intronic
910806266 1:91192227-91192249 AGCTGGAGGTGAGCCCAGAGCGG - Intergenic
912430085 1:109624345-109624367 TGGGGCTGCTGAGCCCAGGGAGG + Intronic
912566614 1:110592151-110592173 TGGTTGGGGTGAGCCCAGGGTGG + Intergenic
913017880 1:114757654-114757676 TGGTGGTGGTGACTAAAGTGGGG - Intronic
914427760 1:147594081-147594103 TGGTTCTGCTGAGCCCAATGAGG - Intronic
914442503 1:147719695-147719717 TGGTGGTGGTGGTTCCAATGAGG - Intergenic
914746448 1:150504929-150504951 AGGTGGTGGTCATCCCTGTGGGG + Exonic
915087362 1:153397717-153397739 TGGTGGGGGTGGGCCCTGAGGGG - Intergenic
917444825 1:175098444-175098466 TGCTGGTGGAGAGACCAGGGAGG + Exonic
918038430 1:180897336-180897358 TGAGGGTTGTGGGCCCAGTGGGG + Intergenic
921161015 1:212472165-212472187 GGGTGATGATGAGCCCAATGAGG - Intergenic
921253245 1:213316953-213316975 TGGTGGGGGTGAGGTCAGAGAGG + Intergenic
922221287 1:223610436-223610458 TGCTGGTGGTGTGGCCAGAGAGG + Intronic
922882490 1:228991183-228991205 TGGGTGTGGTGAGCCCAGCAGGG - Intergenic
923006259 1:230052454-230052476 TGCTGGTGCTGAGACCAGTGTGG - Intergenic
923545470 1:234920249-234920271 GGGTGGTGGTGAGCCCAGCCTGG - Intergenic
1062968661 10:1629496-1629518 GGGTGGTGTTGGGCGCAGTGGGG - Intronic
1063091682 10:2871042-2871064 CGGGGGTGGTGAGGGCAGTGGGG - Intergenic
1063494224 10:6491668-6491690 GTGTGATGGTGAGTCCAGTGGGG - Exonic
1065084999 10:22165185-22165207 GGGTGGTGGTGTGCCTACTGTGG + Intergenic
1066247396 10:33596599-33596621 TGGTGGTGGAGACCACAGAGGGG - Intergenic
1068083985 10:52351495-52351517 TAGTTGTGGTGATCACAGTGAGG + Intergenic
1069744108 10:70703963-70703985 TCGTGGGGCTGAGCCCAGTGTGG + Intronic
1069792664 10:71033029-71033051 TGGTGGTGGTGATGAGAGTGGGG + Intergenic
1069932095 10:71889733-71889755 TGAAGGAGGTGAGCCCAGTGTGG + Intergenic
1070708790 10:78661816-78661838 TGATTGGGGTCAGCCCAGTGGGG - Intergenic
1071592749 10:86891162-86891184 TGGTGGTGGTGGGCTCTGCGTGG + Intronic
1073208800 10:101782422-101782444 TGGTGGTGGTGAGGGGATTGAGG - Intronic
1073552622 10:104417181-104417203 TGGTGCTGGTGGGCCCAGGATGG + Intronic
1074021251 10:109586422-109586444 TGGTAATGGTGAACTCAGTGAGG + Intergenic
1074793166 10:116913042-116913064 TGGTGGTGGTGGTGCTAGTGTGG - Intronic
1076191344 10:128485641-128485663 TGGTGGAGGTGGGCCCTGTGGGG - Intergenic
1076312034 10:129515310-129515332 AGGAGGTGGTGAGCACAGGGCGG + Intronic
1076340409 10:129741518-129741540 TGGAGGTGGTGAGTGCTGTGTGG + Intronic
1076549792 10:131271058-131271080 TGGTATTGCTGAGGCCAGTGGGG - Intronic
1076589203 10:131571636-131571658 CGGTGGTGGTCTTCCCAGTGGGG - Intergenic
1076749201 10:132533836-132533858 TGGGGGTGGTCAGCGCAGTTGGG + Intergenic
1077108935 11:853648-853670 TGGTGGTGGGGGACCCGGTGGGG + Intronic
1077160422 11:1110059-1110081 GGGTGGTGGAGACCCCAGGGAGG + Intergenic
1077188206 11:1244854-1244876 TGGTGGTGGTCAGCACTGTGGGG - Exonic
1077189161 11:1248625-1248647 TGGTGGTGGTCAGCACTGTGGGG - Exonic
1077417146 11:2429644-2429666 TGGTGATGGTGATATCAGTGTGG + Intergenic
1077560360 11:3256649-3256671 CGGTGGTGGGGGGCACAGTGCGG + Intergenic
1077566257 11:3302466-3302488 CGGTGGTGGGGGGCACAGTGCGG + Intergenic
1078194229 11:9121617-9121639 TGGGGCTGCTGAGCCCAGTGTGG + Intronic
1078413455 11:11146769-11146791 GGGAGGTGGTGAGCCCAGTGGGG + Intergenic
1078672128 11:13374959-13374981 TGGTTGGGGAGAGGCCAGTGAGG - Intronic
1079115817 11:17639950-17639972 TGGTGGTGGTGGGGACAGTGAGG + Intronic
1081737275 11:45412768-45412790 AGGAGGTGGTAAGCCCAGTCGGG - Intergenic
1081992330 11:47344517-47344539 TGCTGCTGCTGAGCCCAGGGAGG + Intronic
1082298005 11:50467774-50467796 GGCTGTTTGTGAGCCCAGTGAGG + Intergenic
1083340815 11:61957319-61957341 AGGTGGGGGCGAGCCCAGGGTGG + Intronic
1083434811 11:62634966-62634988 TGGTCGTGATGAGAACAGTGTGG - Exonic
1083904572 11:65661756-65661778 TCGTGGGGGTGAGGCCGGTGAGG + Exonic
1084208741 11:67611230-67611252 TGGTGGGGGGGTGCGCAGTGGGG + Intronic
1084218145 11:67662715-67662737 GGGTGGTGCAGAGACCAGTGTGG + Exonic
1084302767 11:68262112-68262134 TGGTGGTGGTCACCACTGTGGGG + Exonic
1084637583 11:70402476-70402498 TGGTGGTGGTGAGGATAGGGAGG - Intronic
1089083959 11:115801020-115801042 TGGTGGTGGGGAGCAGAGAGAGG + Intergenic
1089430975 11:118424215-118424237 TGGAGGTGACGAGGCCAGTGTGG - Intronic
1089740494 11:120578816-120578838 TTGTGGAGATGAGCCAAGTGAGG - Intronic
1090668303 11:128929760-128929782 TGGTGGTGCTGGGCACAGGGCGG - Intergenic
1090727832 11:129543600-129543622 TGCTTCTAGTGAGCCCAGTGTGG + Intergenic
1091742551 12:2970292-2970314 TGGTCGTGGTTGGCACAGTGTGG + Intronic
1092103968 12:5907863-5907885 TGCTCCTGGGGAGCCCAGTGGGG + Intronic
1093498145 12:19780405-19780427 TGGTTGTGGTGAGTACAGAGTGG + Intergenic
1093703172 12:22245924-22245946 GGGGGGTGGTGTGCCCAGGGAGG + Intronic
1095857115 12:46872568-46872590 TGGTGGTGGTGAGCAGGGTTAGG - Intergenic
1098957966 12:76707048-76707070 TGGTGTTGGTGGGGCCAGGGGGG + Intergenic
1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG + Intergenic
1099432229 12:82601179-82601201 TCGTGGTAGAGAGCTCAGTGAGG + Intergenic
1101348467 12:103906703-103906725 TGGTGGTGGTAACCCAAGGGAGG - Intergenic
1102297033 12:111745100-111745122 TGGTTCAGGTGAGCCCGGTGGGG - Intronic
1104848203 12:131857754-131857776 TGGTGGTGGTGGGTGCTGTGAGG + Intergenic
1104954385 12:132457310-132457332 TGGAGGTTGGAAGCCCAGTGTGG - Intergenic
1105343353 13:19549076-19549098 TTGTGGAGGGGAGCACAGTGGGG - Intergenic
1106528728 13:30567711-30567733 TGCTGGTGGTGAGGCAACTGAGG + Intronic
1107312123 13:39090468-39090490 GTGTGGTGGTGAGGCAAGTGAGG + Intergenic
1108259591 13:48643659-48643681 TGGTGGTGGAGTGCACAGCGGGG - Intergenic
1109468438 13:62770708-62770730 TGGTGGTGGTGAGGAAAGTTGGG + Intergenic
1113853297 13:113430140-113430162 TGGTGGATGGGAGCCTAGTGGGG - Intronic
1115098084 14:29663749-29663771 GGATGGTGCTGACCCCAGTGAGG + Exonic
1115459890 14:33648876-33648898 TGGTGCTGAGGAGCACAGTGTGG + Intronic
1118083904 14:62393803-62393825 TGGTGGTGGTGGAGCCAGTTAGG + Intergenic
1118096666 14:62545344-62545366 TAGTGGTGGTGAGCCCAAGGAGG + Intergenic
1118347099 14:64948343-64948365 TGCTGGTGCTGAGTCCTGTGTGG - Exonic
1118716652 14:68564644-68564666 TGGTGGTGGGGAGCCCTGTGAGG - Intronic
1119476786 14:74935019-74935041 TGGCGGTGGAGAGGCCACTGAGG + Intergenic
1119741049 14:77013980-77014002 TGAGTGTGGTGACCCCAGTGGGG - Intergenic
1119773853 14:77236781-77236803 TGGAAGTGGTCAGCCCAGTGGGG - Intronic
1121376059 14:93411525-93411547 TGGTAGTGGTGACCACAGTGGGG + Intronic
1121414561 14:93770209-93770231 TGGAGGCTGGGAGCCCAGTGAGG - Intronic
1121508050 14:94491495-94491517 TGGTGGTGGTGTGTGTAGTGGGG + Intronic
1121529661 14:94643623-94643645 AGGTGGTGGTGTTCCCAGCGTGG - Intergenic
1122694259 14:103545198-103545220 TGGTGGTGCTCACCCCACTGTGG - Intergenic
1123695467 15:22876039-22876061 TGGGGGTGGTGAGCGCACTGTGG - Intronic
1124267544 15:28250307-28250329 TGGTGGTGGTGAGCCCAGTGAGG - Intronic
1125601498 15:40918165-40918187 TGGTGGAGGTAAGCACAGAGGGG + Intergenic
1126414776 15:48406306-48406328 TGGTAGGGGTGAGGCCTGTGGGG + Intergenic
1127899422 15:63330063-63330085 TGGTGGTGGTGAGCAGAGTAGGG - Intronic
1128568306 15:68715499-68715521 TGGTGGATGTGAGCACAGTGGGG - Intronic
1128638406 15:69317817-69317839 TGCTGGTGCTGAGCTCAGAGAGG - Intronic
1128698990 15:69790171-69790193 TGGTGGTGGTGAGAGCTCTGAGG - Intergenic
1129110554 15:73334661-73334683 TGGTGGTGGGGAGGCAGGTGTGG - Intronic
1129299549 15:74617689-74617711 TGGTGTTTGTCTGCCCAGTGAGG + Intronic
1129503516 15:76061456-76061478 TGGAGGTGGGGAGCCCTGAGGGG + Intronic
1129741419 15:77991439-77991461 GGGTGGTTATGATCCCAGTGGGG + Intronic
1129844244 15:78760968-78760990 GGGTGGTTATGATCCCAGTGGGG - Intronic
1130273553 15:82464817-82464839 TGGAGGTGGTGAGCGGGGTGTGG + Intergenic
1130465904 15:84192188-84192210 TGGAGGTGGTGAGCGGGGTGTGG + Intergenic
1130498361 15:84481348-84481370 TGGAGGTGGTGAGCGGGGTGTGG - Intergenic
1130588193 15:85196784-85196806 TGGAGGTGGTGAGCGGGGTGTGG + Intergenic
1131257880 15:90873483-90873505 TGGTGGTGGTGGGGGCAGGGGGG + Intronic
1131408350 15:92184976-92184998 TGGTGGTGGTGAGAGCAGTGTGG + Intergenic
1131605164 15:93895845-93895867 TGGTGGTGGTGAGAGGAGTATGG + Intergenic
1132929336 16:2450992-2451014 AGGTGGAGGGAAGCCCAGTGGGG - Intronic
1134098237 16:11433802-11433824 AGAGGGTGGTGAGCCCAGAGAGG + Intronic
1135417888 16:22282878-22282900 TGTGGATGGGGAGCCCAGTGGGG + Intronic
1136508531 16:30721861-30721883 TGGTGGTGATTAGCTCAGTCTGG + Intronic
1137631996 16:49953251-49953273 TGGTGGTGAAGAGCCCAGGCAGG + Intergenic
1139371735 16:66473324-66473346 TGGTGGTGGTGACCCCTGTGGGG + Intronic
1140343859 16:74193105-74193127 AGGTGAAGCTGAGCCCAGTGGGG - Intergenic
1140436509 16:74951286-74951308 TGGTGGTGAAGAGCACAGTGAGG - Intronic
1141946538 16:87314584-87314606 TGGTGGTGGTGGGTTCAGGGGGG + Intronic
1142190148 16:88713675-88713697 TGGTGGTGGTGCGGCCCATGCGG + Exonic
1142419495 16:89961732-89961754 TGCAGGGGGTGTGCCCAGTGAGG + Exonic
1142803202 17:2357933-2357955 TTGTGGTGGTGCACCCAGGGTGG + Intronic
1142810061 17:2391737-2391759 TGGTCCTGGAGAGACCAGTGGGG - Intronic
1143163763 17:4887267-4887289 TGGGGGTGGTGGGCACAGAGAGG + Intronic
1143873501 17:9974833-9974855 GGGTGGGGGTGAGCCCTGGGTGG - Intronic
1144053758 17:11520237-11520259 TGGTGGTGGTGAGACAGGTGGGG - Intronic
1145789218 17:27614745-27614767 TGGTTGTTTTGAGACCAGTGTGG + Intronic
1146305285 17:31725661-31725683 AGGCGGTGATGAGCCCAATGAGG + Intergenic
1147390444 17:40106131-40106153 TGCTGGTGGTGAGGAGAGTGGGG + Intergenic
1147503863 17:40994043-40994065 TGGTGGTGGCAGGCCCGGTGGGG + Exonic
1147504297 17:40999799-40999821 TGGTGGTGGCAGGCCCAGTGGGG + Exonic
1147504764 17:41004697-41004719 TAGTGGTGGCCAGGCCAGTGGGG + Intergenic
1147656041 17:42091636-42091658 TGGGGGTGGAGAGGCCAGAGGGG - Intergenic
1148087434 17:45002761-45002783 TGGTGTTGGTGGGCCGGGTGCGG + Intergenic
1148205327 17:45776108-45776130 TGGTGAAGGGGAGCCCAGGGAGG - Intergenic
1150053680 17:61991401-61991423 AGGTTGTGGTGAGCCAAGTTGGG - Intronic
1151282951 17:73090071-73090093 TGGCAGGGCTGAGCCCAGTGTGG - Intronic
1151330009 17:73401098-73401120 TGTAGGTGGTGAGCGCGGTGAGG + Exonic
1152034460 17:77863638-77863660 GGTTGCTGGTGAGCCCAGAGAGG + Intergenic
1152063076 17:78093699-78093721 TGTTGATGGTAGGCCCAGTGGGG - Exonic
1152382022 17:79947069-79947091 TGGTGGGGCTGAGCCCAGCTGGG - Intronic
1152464469 17:80458068-80458090 TGGTGTTGGTGACCCCACTGTGG + Intergenic
1152925846 17:83087435-83087457 TGGAGGTGCTCAGCCCAGGGAGG - Intronic
1152931843 17:83113961-83113983 TGGTGGTGGGGGGCACAGAGGGG + Intergenic
1153408578 18:4768045-4768067 TGGTGGTGATGAAGCCAGTTTGG - Intergenic
1156536747 18:37871775-37871797 AAGTGGTGGTGGGGCCAGTGGGG + Intergenic
1159131424 18:64284010-64284032 TGGTGGTGGTGAGCTGAGATCGG + Intergenic
1160219947 18:76967715-76967737 AGGTGGTGGTGTGCTCTGTGAGG + Intronic
1160437766 18:78865048-78865070 TGCTGCTGGTGAGCCCAGCTGGG - Intergenic
1161734729 19:5984611-5984633 TGGTGGAGATGAGCTCAGGGAGG + Intergenic
1162969212 19:14170024-14170046 TGGTAATGGGGAGACCAGTGAGG + Intronic
1163717629 19:18881109-18881131 TGGTGGTGGTGTCCAAAGTGAGG - Intronic
1164462372 19:28459976-28459998 TGGTGGCTGGGAGCCCAGTGAGG + Intergenic
1164666047 19:30037902-30037924 TGGGGTTGGTGTGCCTAGTGTGG - Intergenic
1164912876 19:32026687-32026709 TGGTGGTGGGGAGAACAGAGTGG - Intergenic
1165246688 19:34501859-34501881 TGGAGGAGGTGATCCCACTGGGG + Exonic
1165420669 19:35720624-35720646 TGGTGGTGGAGGGCAGAGTGGGG - Exonic
1165480652 19:36061702-36061724 AGGAGGTGGTGTGGCCAGTGTGG + Intronic
1166042564 19:40212739-40212761 TGGAGGCTGGGAGCCCAGTGGGG + Intronic
1166086701 19:40480770-40480792 TGGTGGTGTTGGGCCAGGTGTGG + Intronic
1167478098 19:49712551-49712573 TGTGGGTGGTGAGACGAGTGAGG + Intronic
1168519539 19:57037484-57037506 TGGAGGTGGGGAGCCCCATGAGG - Intergenic
925163313 2:1701795-1701817 TGGCGGTGGTGCCCCCAGGGTGG + Intronic
925165531 2:1713556-1713578 TGGTGCTGGAGCGGCCAGTGGGG - Intronic
926045676 2:9708051-9708073 AGGAGGTGGTGATCCCAGGGAGG - Intergenic
928058070 2:28078670-28078692 GGGTGGGGGTGAGCACACTGAGG + Intronic
929630873 2:43460788-43460810 TGGTGGGGGAGAGCCCACAGAGG + Intronic
929845265 2:45519309-45519331 AGGTGGTAGTGAGGCCAGTGGGG - Intronic
930108390 2:47657743-47657765 TACTGGAGCTGAGCCCAGTGGGG + Intergenic
930211799 2:48646911-48646933 TGCTGGTGGAGAGCCCCATGAGG - Exonic
930894411 2:56428573-56428595 AGGTTGTGGTGAGCCCAGGTCGG - Intergenic
931134244 2:59378296-59378318 AGGCGGTGGTGGGCACAGTGGGG - Intergenic
933253957 2:80059743-80059765 TGGTGATGGAGAGCAGAGTGGGG - Intronic
933714578 2:85350684-85350706 TGGGGGTGGAGAGTGCAGTGCGG - Intronic
934220053 2:90074374-90074396 GGGTGGAGGAGAGCTCAGTGGGG - Intergenic
935484016 2:103630227-103630249 TGGTTGTGGTGAGCACACTCTGG + Intergenic
935687116 2:105694096-105694118 TGGAGAGGGTGAGCCCAGAGTGG - Intergenic
936011570 2:108928428-108928450 TGGCAGTGATGAGGCCAGTGGGG - Intronic
936045986 2:109188352-109188374 TGGAGGTGGTGATCACTGTGAGG - Intronic
936261838 2:110966452-110966474 TGGTGTCTGTGGGCCCAGTGAGG + Intronic
936500829 2:113065028-113065050 TGGTGGTTGAGAGTCCACTGAGG + Intronic
937939927 2:127277221-127277243 TGCTGGTGGGGATCCCACTGGGG + Intronic
938278465 2:130048722-130048744 TGCTGGTGGTGGTCCCGGTGTGG - Intergenic
938329440 2:130439581-130439603 TGCTGGTGGTGGTCCCGGTGTGG - Intergenic
938360508 2:130681922-130681944 TGCTGGTGGTGGTCCCGGTGTGG + Intergenic
938370977 2:130768268-130768290 TGGTGATGGAGAGCCCAGCCAGG + Intergenic
938436911 2:131288630-131288652 TGCTGGTGGTGGTCCCGGTGTGG + Intronic
938689699 2:133776244-133776266 AGGTGGTGGTGATGTCAGTGGGG + Intergenic
939864830 2:147461043-147461065 TGGTGGTGGTGTGGGCAGTGAGG - Intergenic
944504142 2:200392361-200392383 TTGGGGTGGTGAACCCAGAGAGG + Intronic
944536709 2:200717475-200717497 TGGTGCTGGTGACCACAGTCAGG - Intergenic
944939992 2:204613975-204613997 TGGTGGTGGTTTTCCCTGTGAGG + Intronic
945907666 2:215613397-215613419 TCGCAGTGTTGAGCCCAGTGCGG - Intergenic
946242418 2:218364759-218364781 TGCTGATGGTGGGCCCAGAGGGG + Intronic
947592775 2:231395052-231395074 TGGTGGTGGGGAGCCCTCAGAGG + Intergenic
947866730 2:233402998-233403020 TGGTGGTGGTTAGCCTTGGGAGG + Intronic
948221338 2:236272109-236272131 TGGTGGCAGTGAGCACTGTGAGG + Intergenic
948867969 2:240784908-240784930 GGGTGGTGGTCAGGCCAGTGGGG - Intronic
948873765 2:240816990-240817012 TGAGGGTGGGGATCCCAGTGGGG + Intronic
1168793812 20:597802-597824 TGGTGGTTGAGAGCCCAGTGGGG + Intergenic
1170653904 20:18268229-18268251 GGAGGGTGGTGAGCCCAGGGAGG + Intergenic
1171385094 20:24764511-24764533 TCGTGGTGGCAAGCCTAGTGGGG - Intergenic
1172106041 20:32517810-32517832 TGGTGAGGGTGAGCCTATTGTGG - Intronic
1172243794 20:33431794-33431816 TCATGGTGTTGAGCACAGTGTGG + Intronic
1173331370 20:42078708-42078730 TGGGGGAGGCCAGCCCAGTGCGG - Exonic
1173693896 20:44990607-44990629 TGGTGGTGGTGGTGGCAGTGGGG + Intronic
1175466203 20:59192483-59192505 CGGTGGTGGAGAGCTGAGTGGGG - Exonic
1175859566 20:62143141-62143163 TGGGGCTGGGGAGCCCAGAGAGG - Intronic
1176245920 20:64096789-64096811 TGGTGGTGGTGAGGATGGTGAGG - Intronic
1177770870 21:25514073-25514095 TGTTGGAGGTGGGCCTAGTGCGG - Intergenic
1180076496 21:45465958-45465980 TCTTGGTGGAGAGCCCAGTTTGG + Intronic
1180126096 21:45791158-45791180 TGTTGGTCGTCAGCCCAGCGTGG + Intronic
1181557969 22:23683075-23683097 GGGTGGGGGTTAGTCCAGTGAGG - Intergenic
1182000377 22:26914936-26914958 TGGTGGAGGTGTGCCGAGGGTGG + Intergenic
1182676688 22:32044385-32044407 TGGAGGTGATAAGCCCAGGGAGG + Intronic
1182792904 22:32967798-32967820 GGGCTGGGGTGAGCCCAGTGGGG + Intronic
1183265446 22:36822415-36822437 TGGTTGTGATGAGCTCAGTTTGG + Intergenic
1183522401 22:38303123-38303145 GGGTGGCGGTGAGCGCAGGGTGG - Exonic
1183866828 22:40710829-40710851 TGGCCGTGGGGAGCCAAGTGTGG - Intergenic
1184369134 22:44071519-44071541 TGGAGGGGGTGATCCCAATGAGG - Intronic
1185281526 22:49971941-49971963 TGGCTGTGGGGCGCCCAGTGGGG + Intergenic
950583141 3:13876065-13876087 TGGGGGTGGTGAGGAAAGTGAGG + Intronic
951369647 3:21829643-21829665 TGGTGGTAGTGAGACAAGTTGGG + Intronic
952203940 3:31160369-31160391 TGTTGGTGGTGAGGCTACTGTGG - Intergenic
953346064 3:42176658-42176680 TGGTGGTGGTGAGTACATTGCGG + Intronic
953728763 3:45426840-45426862 TGGTAGTCATGAGCCCAGTCAGG + Intronic
954800983 3:53186710-53186732 TGGTGGGGAAGGGCCCAGTGTGG + Intronic
955379089 3:58422346-58422368 TGGTTGTTGTAGGCCCAGTGAGG + Intronic
956560130 3:70565819-70565841 TGGAGGTGGTGCACCCAGGGAGG - Intergenic
957937386 3:86962410-86962432 GAGTGGTGGTGAGGACAGTGAGG - Intronic
960597806 3:119422453-119422475 TGGTCCTGGTGAGAACAGTGGGG - Intergenic
961393317 3:126569518-126569540 TGGTGGGACTGTGCCCAGTGAGG + Intergenic
961543903 3:127618823-127618845 TTGTGGAGATGAGCCCTGTGGGG + Intronic
961811363 3:129523622-129523644 TGGTGGGGCTGAGCCATGTGGGG + Intergenic
963055087 3:141179670-141179692 TGGTGGAGGTGAGCCTGGTGTGG - Intergenic
963259197 3:143176422-143176444 TGGTGGCGGAGACCCCGGTGGGG + Intergenic
964514625 3:157494460-157494482 TGGATGTGGAGTGCCCAGTGTGG - Intronic
964904179 3:161697832-161697854 TGGATGTTGTGAGCCCAGTGAGG - Intergenic
965389628 3:168089633-168089655 TGGTGGTATTGTGCGCAGTGAGG - Intronic
967303326 3:188038023-188038045 TGGTGGTGCTGTGGCCAGTGTGG - Intergenic
967892775 3:194374972-194374994 GGGTGGAGGAGAGCCCAGTGTGG - Intergenic
967940519 3:194762770-194762792 TGGTTGTGATGTTCCCAGTGTGG + Intergenic
968090988 3:195898061-195898083 GGGTGATGCTGAGCCCAGTTTGG - Intronic
969221411 4:5761272-5761294 AGGAGATGTTGAGCCCAGTGGGG + Intronic
969280893 4:6170248-6170270 TGGTGGTGGTGAGAAGGGTGGGG - Intronic
969280913 4:6170335-6170357 TGGTGGTGGTGAGAAGGGTGGGG - Intronic
969314372 4:6372650-6372672 TGGTGGAGGTGAGCCCTCGGAGG - Exonic
969522059 4:7684105-7684127 TGGTGGTGGTGAGCTCCCTGCGG - Intronic
969846647 4:9924921-9924943 TGGGGATAATGAGCCCAGTGGGG - Intronic
971451506 4:26805628-26805650 TGGAGGTGGGGAGCCCAGATGGG - Intergenic
972641979 4:40933530-40933552 TGGTGGTGACCAGCCCAGTCTGG - Intronic
974119242 4:57618952-57618974 CGGTGGAGGTGAGGCCTGTGAGG + Intergenic
974615376 4:64272688-64272710 TGGTGAGAGTGAGCCAAGTGTGG - Intergenic
976604877 4:86973262-86973284 TGGAGGTGGAGAGACCAGTTTGG + Intronic
976871030 4:89793832-89793854 TGGTGGTGGTGCCAGCAGTGGGG + Intronic
977537506 4:98272051-98272073 TGGTGGTGCTGTTCCCAGTGTGG - Intronic
977554769 4:98477474-98477496 GGGTGCTGATGAGCTCAGTGGGG - Intronic
978291649 4:107149068-107149090 TGGTGGTGTTGATCCCTGTATGG - Intronic
979715952 4:123838379-123838401 TGTTGTTGGTGGGCCCACTGTGG - Intergenic
983437624 4:167734834-167734856 TGTTGGTGGTAAGCAGAGTGGGG + Intergenic
984273836 4:177583429-177583451 TGGTGGTGATGAACCCACTGTGG - Intergenic
985554544 5:551311-551333 TGGTGGTGGTTTCACCAGTGTGG + Intergenic
985774196 5:1832144-1832166 TGGTGATGGTGAGCACACAGAGG - Intergenic
990339501 5:54808524-54808546 CAGTGGTGAAGAGCCCAGTGTGG - Intergenic
991510013 5:67365833-67365855 TGGTGGAGGGGACCCCACTGGGG - Intergenic
991706687 5:69365237-69365259 TGGGGTTGGTGTGCCTAGTGTGG + Exonic
992269242 5:75049436-75049458 TGGGGATGGTGGGCTCAGTGTGG - Intergenic
992552871 5:77875742-77875764 TGGTGGTGGTGGTGGCAGTGAGG + Intergenic
993189828 5:84668288-84668310 GGAGGGTGGTGAGCCCAGGGAGG + Intergenic
995650485 5:114362704-114362726 TGCTGGTGGTGCGCCGGGTGCGG - Exonic
997587794 5:135054000-135054022 CTGTGGTGGTGACCCCTGTGAGG + Intronic
997642787 5:135460428-135460450 TGGTGGGGGTGAGCCATGTGAGG - Intergenic
997703024 5:135918126-135918148 TGGAGGTGGTGAGGCCAGCTAGG + Intergenic
999694427 5:154176225-154176247 TGCTGGAGGTGTGCCTAGTGGGG + Intronic
1000117092 5:158163628-158163650 TGGTTGGGGTGAGCAGAGTGAGG + Intergenic
1001122401 5:168991536-168991558 TGGGGGTGGTGGGGGCAGTGGGG - Intronic
1001258179 5:170201253-170201275 GGGTGCTGGTGTGCCCAGAGTGG - Intergenic
1001426437 5:171625666-171625688 AGCCGGTGGCGAGCCCAGTGAGG + Intergenic
1001669990 5:173465869-173465891 TGGGGCTGGTGGGCCAAGTGTGG - Intergenic
1002054631 5:176591622-176591644 TGGTGGTGGTGATGGTAGTGAGG + Intronic
1002182610 5:177438727-177438749 TGGAAGTGGGGAGGCCAGTGAGG + Intronic
1002471589 5:179438970-179438992 TGGTGGTTGTGAGGACTGTGTGG - Intergenic
1003056496 6:2825391-2825413 AGGTTGTGGTGAGCCAAGTTTGG + Intergenic
1003245425 6:4378385-4378407 TGGGGGAGCTGAGCTCAGTGGGG + Intergenic
1005710594 6:28500498-28500520 TGGCGGTTGTGAGAGCAGTGAGG - Intergenic
1006572564 6:35017753-35017775 TGGTGGTGGGCAGGCCTGTGAGG - Exonic
1006719895 6:36143256-36143278 GGGTGGTGCTGCCCCCAGTGAGG + Intronic
1006830124 6:36963506-36963528 TGGAGGAGGTGTGCCCCGTGTGG - Exonic
1010752570 6:79631499-79631521 TCGTGGCGGTGAGCGCGGTGGGG + Exonic
1014935609 6:127381611-127381633 TGGTAGTGGTGTACACAGTGTGG + Intergenic
1015446845 6:133316043-133316065 AGGTGGTGCTGAGCCCAGCCAGG - Intronic
1015504264 6:133965519-133965541 TGGTGGTGCTGAGGGGAGTGGGG - Intronic
1017063946 6:150511276-150511298 TGGTGGTGATGGCCACAGTGAGG + Intergenic
1017959769 6:159211216-159211238 AGTTGGTGGTCAGCGCAGTGGGG + Intronic
1017987434 6:159456087-159456109 TGGTGGTGGTGCTCCCCGGGTGG - Intergenic
1019723178 7:2586094-2586116 TGTTGGTTGTGAGCTCAGAGTGG - Intronic
1021873735 7:25029273-25029295 TGGCAGTGGTGAGACCAGTGGGG + Intergenic
1022046776 7:26628031-26628053 TGGGGGTGGAGAGCCCAGCATGG - Intergenic
1022143388 7:27513018-27513040 TGTTAGTGCTCAGCCCAGTGGGG - Intergenic
1022234562 7:28448422-28448444 TGGTGTTGGAGAGCTCAGTTTGG + Intronic
1023682323 7:42700010-42700032 TGGTGGTGGTGAAGGCAGCGAGG + Intergenic
1024493988 7:50021772-50021794 GGGTGGTGGTGTGCCCAAAGTGG + Intronic
1025196816 7:56940471-56940493 TGTTGGGGGAGAGGCCAGTGAGG + Intergenic
1025675132 7:63636466-63636488 TGTTGGGGGAGAGGCCAGTGAGG - Intergenic
1027232698 7:76281843-76281865 TAGTGGAGGGGAGCCCTGTGCGG - Intronic
1029606595 7:101602828-101602850 TGGGGCTGGAGAGCTCAGTGAGG - Intergenic
1029709543 7:102292115-102292137 TGGTGGAGGTGAGCAGAGTGAGG + Intronic
1031597901 7:123669116-123669138 TGGTGGTGGTAAGACCAGTTAGG + Intergenic
1033594363 7:142845609-142845631 TGCTGGAGGTGGGCCTAGTGGGG + Intergenic
1033821096 7:145134736-145134758 TGGTGTATGGGAGCCCAGTGAGG - Intergenic
1034969758 7:155411498-155411520 TGCTGTGGGTGAGCCCTGTGGGG - Intergenic
1035040637 7:155924475-155924497 TGTTGGAGGTGGGCCTAGTGGGG + Intergenic
1035290683 7:157836910-157836932 AGGTGGTGGTGAGTGCAGGGTGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1037680126 8:21090182-21090204 TGGTGGCTGTGGACCCAGTGAGG - Intergenic
1037690850 8:21180240-21180262 CAGTGGTGTTGAACCCAGTGTGG - Intergenic
1037766887 8:21777693-21777715 TGGTGGTGGTAATGGCAGTGAGG + Intronic
1038703617 8:29874070-29874092 TGGTGGGGGAGATCACAGTGGGG + Intergenic
1040349534 8:46550455-46550477 TGGTGTTAGTGAGCCCAGATAGG + Intergenic
1040460740 8:47645372-47645394 TGGTGGTGGTGTGGTCATTGAGG + Intronic
1040598355 8:48861309-48861331 GGGTGGTGGAGAGCACGGTGTGG + Intergenic
1041786887 8:61644844-61644866 TGGTGGTTGTCAGCCTTGTGGGG - Intronic
1042004754 8:64168751-64168773 AGGTGGAGCTGAGCCCAGGGTGG + Intergenic
1044071200 8:87762442-87762464 TGATGGTGAGGAGCCCAGTGGGG + Intergenic
1044745305 8:95365218-95365240 TCGTCCTTGTGAGCCCAGTGGGG + Intergenic
1045365453 8:101471595-101471617 TGGTGGTGGTGGTGGCAGTGAGG + Intergenic
1048897949 8:139011296-139011318 AGGTTGTGGTGAGCCCAGCCTGG - Intergenic
1049228504 8:141469825-141469847 TGGTGGTGATGATGACAGTGGGG + Intergenic
1049284916 8:141769395-141769417 TGGTGGGGGGGAGGCCTGTGTGG - Intergenic
1049637651 8:143697637-143697659 TGGTGGTGAGGAGCCCATGGGGG + Intronic
1050041171 9:1495490-1495512 TGGTGGTGAGGAGAACAGTGGGG + Intergenic
1055959284 9:81804713-81804735 AGGTGGTGGTGAGAAGAGTGAGG + Intergenic
1057200783 9:93138808-93138830 TGGAGGTGGGCAGCCCAGGGAGG - Intergenic
1058138184 9:101330313-101330335 GGGTGGTGCTGATCCCAATGAGG + Intergenic
1058213284 9:102200225-102200247 TGGTGGTAGTGGGCCGGGTGCGG + Intergenic
1060524377 9:124312254-124312276 AGGTGGTGATGAGGGCAGTGGGG + Intronic
1060671203 9:125471350-125471372 TGGTGGAGGAGAGATCAGTGAGG + Intronic
1060745755 9:126129803-126129825 AGGTGGTGAGGACCCCAGTGAGG + Intergenic
1060896183 9:127219024-127219046 TGCAGGTGGTGGGCCCAGAGAGG - Exonic
1061584229 9:131555762-131555784 GAGGGGTGGCGAGCCCAGTGAGG + Intergenic
1062054516 9:134463905-134463927 TGGTGGTGTTGGGGCCAGGGAGG + Intergenic
1062090103 9:134671592-134671614 AGCTGCGGGTGAGCCCAGTGGGG - Intronic
1186455920 X:9709710-9709732 TGCTGGTGGCGGGCCCAGTGGGG - Exonic
1186808792 X:13166705-13166727 TGGGGATGGTGAGCACAGAGTGG + Intergenic
1187285422 X:17899227-17899249 TGGTGGTGGAGAGCTATGTGGGG + Intergenic
1188582360 X:31729363-31729385 TGGGTGTGGTGACCACAGTGTGG - Intronic
1190279495 X:48919734-48919756 GGATGGGGGTGAGCCCAGAGTGG + Intergenic
1190301068 X:49057873-49057895 TGGTGGTGGTGGGCGGGGTGAGG + Intronic
1191111416 X:56805579-56805601 GGGTGGTGGTGGGGGCAGTGGGG + Intergenic
1191915826 X:66200316-66200338 TGGTGGAGGTGAGGCCAGAAAGG + Intronic
1192320631 X:70087630-70087652 TGGTGGTGGTGGCCCCAGTTGGG + Intergenic
1197802105 X:130361771-130361793 CGTTGATGGTGAGCCCGGTGTGG + Intronic
1198296620 X:135293464-135293486 TGATGGTGGTGGGCCTAGTCTGG - Intronic