ID: 1124272976

View in Genome Browser
Species Human (GRCh38)
Location 15:28300135-28300157
Sequence TAGTCATTGGTACTTGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 4, 1: 0, 2: 2, 3: 15, 4: 142}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124272976_1124272986 -1 Left 1124272976 15:28300135-28300157 CCAAAAGCAAGTACCAATGACTA 0: 4
1: 0
2: 2
3: 15
4: 142
Right 1124272986 15:28300157-28300179 ACCTACGGGGAAATGGGGAGGGG 0: 4
1: 0
2: 2
3: 13
4: 143
1124272976_1124272988 5 Left 1124272976 15:28300135-28300157 CCAAAAGCAAGTACCAATGACTA 0: 4
1: 0
2: 2
3: 15
4: 142
Right 1124272988 15:28300163-28300185 GGGGAAATGGGGAGGGGACATGG 0: 4
1: 1
2: 25
3: 192
4: 1472
1124272976_1124272989 12 Left 1124272976 15:28300135-28300157 CCAAAAGCAAGTACCAATGACTA 0: 4
1: 0
2: 2
3: 15
4: 142
Right 1124272989 15:28300170-28300192 TGGGGAGGGGACATGGACAAAGG 0: 4
1: 0
2: 8
3: 55
4: 524
1124272976_1124272984 -3 Left 1124272976 15:28300135-28300157 CCAAAAGCAAGTACCAATGACTA 0: 4
1: 0
2: 2
3: 15
4: 142
Right 1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG 0: 4
1: 0
2: 1
3: 4
4: 64
1124272976_1124272981 -8 Left 1124272976 15:28300135-28300157 CCAAAAGCAAGTACCAATGACTA 0: 4
1: 0
2: 2
3: 15
4: 142
Right 1124272981 15:28300150-28300172 AATGACTACCTACGGGGAAATGG 0: 4
1: 0
2: 0
3: 8
4: 102
1124272976_1124272982 -7 Left 1124272976 15:28300135-28300157 CCAAAAGCAAGTACCAATGACTA 0: 4
1: 0
2: 2
3: 15
4: 142
Right 1124272982 15:28300151-28300173 ATGACTACCTACGGGGAAATGGG 0: 4
1: 0
2: 0
3: 5
4: 57
1124272976_1124272985 -2 Left 1124272976 15:28300135-28300157 CCAAAAGCAAGTACCAATGACTA 0: 4
1: 0
2: 2
3: 15
4: 142
Right 1124272985 15:28300156-28300178 TACCTACGGGGAAATGGGGAGGG 0: 4
1: 0
2: 1
3: 4
4: 107
1124272976_1124272990 19 Left 1124272976 15:28300135-28300157 CCAAAAGCAAGTACCAATGACTA 0: 4
1: 0
2: 2
3: 15
4: 142
Right 1124272990 15:28300177-28300199 GGGACATGGACAAAGGCAGCAGG 0: 4
1: 0
2: 1
3: 25
4: 301
1124272976_1124272983 -6 Left 1124272976 15:28300135-28300157 CCAAAAGCAAGTACCAATGACTA 0: 4
1: 0
2: 2
3: 15
4: 142
Right 1124272983 15:28300152-28300174 TGACTACCTACGGGGAAATGGGG 0: 4
1: 0
2: 0
3: 7
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124272976 Original CRISPR TAGTCATTGGTACTTGCTTT TGG (reversed) Intronic
908536965 1:65087288-65087310 TAGTCAGTGGTACTTTGTTATGG + Intergenic
909234652 1:73137353-73137375 TAGAAAATGGTACTTGCTTTGGG - Intergenic
910075693 1:83275851-83275873 TGGTCATTTGTAATTGCTTCTGG + Intergenic
911334677 1:96567863-96567885 TAGACACTAGTAATTGCTTTAGG - Intergenic
911912365 1:103652689-103652711 TAGTCTTTGGTCCTTGGTTTAGG + Intergenic
911916089 1:103699259-103699281 TAGTCTTTGGTCCTTGGTTTAGG - Intronic
911919779 1:103746827-103746849 TAGTCTTTGGTCCTTGGTTTAGG + Intronic
912197034 1:107410091-107410113 TAGTCATTGATTCCTTCTTTGGG - Intronic
912980657 1:114368745-114368767 TAGATTTTGGTACTGGCTTTTGG - Intergenic
913710261 1:121475989-121476011 AAGGCATTGGTGCTTGCTGTAGG + Intergenic
916655413 1:166871007-166871029 TAGTCATTTATATTTGTTTTAGG + Intronic
916824969 1:168434526-168434548 TAGGCATGGGTACTTGCTGAGGG - Intergenic
921355169 1:214279289-214279311 TAGTCCTAGGTCCTTGCATTTGG - Intergenic
923064218 1:230503405-230503427 CAGTCCTTGGTACTTGGTTATGG + Intergenic
1062761008 10:19117-19139 TAGTTACTGCTGCTTGCTTTTGG - Intergenic
1065858784 10:29852819-29852841 GAGTCTTTGGTAGTTTCTTTCGG + Intergenic
1072354682 10:94595961-94595983 TTGTAATTGGAACTTGCATTGGG + Intronic
1074572919 10:114640972-114640994 TAGTGCTAGGTACTTTCTTTTGG - Intronic
1075352581 10:121737184-121737206 TAGTCATTCGTACTTTCTGCAGG + Intergenic
1079048402 11:17130066-17130088 TAGTCATTTTTATTTCCTTTTGG + Intronic
1083197446 11:61096999-61097021 TAGTCCTTGGTCCCTGGTTTAGG - Intergenic
1086352869 11:85960655-85960677 TAGGTATTGCTACTTGTTTTGGG - Intronic
1087788265 11:102379947-102379969 CAGTCATTGGTACTTTGTTGTGG + Intergenic
1088142103 11:106629993-106630015 AAGTCATTGGTCTTGGCTTTAGG - Intergenic
1090502307 11:127273323-127273345 TAGGCATTGGTCCTTCCGTTGGG - Intergenic
1092565845 12:9664635-9664657 TAGTAATTCATACCTGCTTTAGG - Intergenic
1095287086 12:40425784-40425806 GAGTCATGGGTATTTGCTCTGGG - Intronic
1099211387 12:79793268-79793290 TTGTCATTCAAACTTGCTTTAGG + Intronic
1099229978 12:80012297-80012319 TAATTATTCCTACTTGCTTTTGG + Intergenic
1101815333 12:108141731-108141753 TAGTCACAGGTTCCTGCTTTTGG + Intronic
1106350568 13:28925873-28925895 TAGTCATATCTACTTTCTTTTGG - Intronic
1106727808 13:32504254-32504276 TAGTCTTTGGTACTTTGTTGTGG - Intronic
1107225372 13:38043011-38043033 TAGTAATTGGTAAATGCTCTTGG - Intergenic
1108264663 13:48694595-48694617 GAGTCAAGGGTACTTGCTTAAGG + Intronic
1113109869 13:106811729-106811751 TATTCAGTGGTATTTGCTTAGGG + Intergenic
1113960431 13:114122834-114122856 CAGCCAGTGGTCCTTGCTTTGGG - Intronic
1114386269 14:22258614-22258636 TAGTCATTGGTTTTTGTCTTTGG + Intergenic
1116892052 14:50278113-50278135 CATTCAGTGGTTCTTGCTTTAGG + Intronic
1123462287 15:20484137-20484159 TAGTCATTGGTACTTGCTTTCGG - Intergenic
1123655772 15:22516257-22516279 TAGTCATTGGTACTTGCTTTCGG + Intergenic
1124272976 15:28300135-28300157 TAGTCATTGGTACTTGCTTTTGG - Intronic
1124309682 15:28611434-28611456 TAGTCATTGGTACTTGCTTTCGG + Intergenic
1129581064 15:76810865-76810887 TAGTCATTTCTACTTTCTTTTGG - Intronic
1130139569 15:81213280-81213302 AAGTTATTGAGACTTGCTTTAGG + Intronic
1133420162 16:5639157-5639179 TAGTCACTTGAACTTGCTTTTGG + Intergenic
1144470572 17:15536583-15536605 AATTCATTGTTACTTGGTTTAGG + Intronic
1144925770 17:18807089-18807111 AATTCATTGTTACTTGGTTTAGG - Intergenic
1147047741 17:37767299-37767321 AAGTCATTGGTTCTTGTTTTGGG - Intergenic
1147197525 17:38777517-38777539 TGATCATTTGCACTTGCTTTAGG + Intronic
1149072814 17:52563282-52563304 TAGTCATAGGTACGTGCATCTGG + Intergenic
1149579142 17:57736297-57736319 TCGTCAATGGTTATTGCTTTGGG - Intergenic
1150655300 17:67035281-67035303 TGTTCATTGGCTCTTGCTTTTGG - Intergenic
1152953915 18:19471-19493 TAGTTACTGCTGCTTGCTTTTGG - Intergenic
1152996309 18:409570-409592 AACTCATTGGTACTTTCTATAGG - Intronic
1153414557 18:4832328-4832350 AAGTCATTTGTATTTGATTTTGG + Intergenic
1157680741 18:49603420-49603442 CAGTCATTGCTACCTGCTGTGGG + Intergenic
1158303340 18:56077270-56077292 AAGTCATTGGTCTTTGCTCTTGG + Intergenic
1159349240 18:67250323-67250345 TTGTCACTGCTACCTGCTTTAGG - Intergenic
1159561781 18:70002936-70002958 AAGTGATTAGTACTTGATTTTGG + Intergenic
1159672990 18:71246191-71246213 GAGTCAATGGTATTTGCTGTGGG - Intergenic
1160391941 18:78540543-78540565 TAGTCTGTGGCACTTGCTTGGGG + Intergenic
924968965 2:106409-106431 TAGCTATTTCTACTTGCTTTTGG + Intergenic
926847228 2:17154974-17154996 TAGTAATTTGTACTTTATTTAGG - Intergenic
929956288 2:46460947-46460969 TAGTCATTACAACTGGCTTTGGG + Intronic
930015135 2:46964866-46964888 TAGTCATTGGTGCCTAATTTAGG + Intronic
932058352 2:68468901-68468923 GAACCATTGGTACTTGCCTTAGG + Intronic
932942210 2:76180891-76180913 TTTTCATTGTTACTTGCTGTGGG + Intergenic
940131205 2:150384974-150384996 TAGCTATTCCTACTTGCTTTTGG + Intergenic
942818911 2:180087187-180087209 TGGTCATTGGTCTTTGTTTTAGG + Intergenic
944631406 2:201629258-201629280 GAGTCTTCTGTACTTGCTTTTGG - Exonic
946567032 2:220977769-220977791 TAATCATAGGTACTTGCAGTAGG + Intergenic
1169039487 20:2481215-2481237 TAGTCATGAGTCATTGCTTTGGG - Intronic
1177057687 21:16328987-16329009 TGGTCATTGGTACTCACTCTAGG + Intergenic
1178438332 21:32578812-32578834 TAGGCATTGGAACCTGCTTTTGG - Exonic
1184063788 22:42103229-42103251 TAGCTACTCGTACTTGCTTTTGG + Intergenic
950095860 3:10329984-10330006 CAGTTATTGGAGCTTGCTTTGGG + Intronic
950238584 3:11346726-11346748 AAGTCACTTGTGCTTGCTTTGGG - Intronic
951973713 3:28479106-28479128 TAGTCATTGAAAATTGTTTTAGG - Intronic
952199904 3:31115323-31115345 TAGTCTGTGGTACTTGGTTATGG + Intergenic
952462733 3:33546212-33546234 TACTCATTGGTAAATGGTTTGGG - Intronic
952636345 3:35537337-35537359 GAGTCATAGGTGCTGGCTTTTGG - Intergenic
956682496 3:71794213-71794235 TAGTCATTGTTTCTTCCTTTTGG - Intergenic
956686722 3:71835958-71835980 CAGTCATTGGGTTTTGCTTTAGG - Intergenic
962527295 3:136248211-136248233 CAGAAATTGGGACTTGCTTTTGG - Intergenic
965291190 3:166883389-166883411 TAGTTACTCCTACTTGCTTTTGG - Intergenic
967741377 3:193006550-193006572 TAGTTATTCCTGCTTGCTTTTGG + Intergenic
969312585 4:6362542-6362564 TATTTCTTGGTTCTTGCTTTAGG - Intronic
971711137 4:30114145-30114167 AAGTCCTTGATACATGCTTTGGG - Intergenic
972118900 4:35675991-35676013 TAGTCATTTCTAATTTCTTTAGG + Intergenic
974517678 4:62938183-62938205 AAGTCCTTTTTACTTGCTTTTGG + Intergenic
975787667 4:77909456-77909478 CAGTCATTTGAACTTGTTTTTGG + Intronic
977286375 4:95112428-95112450 TTTCCATTTGTACTTGCTTTAGG + Intronic
977634230 4:99277976-99277998 TAGTAATTGATACATCCTTTTGG - Intronic
977636898 4:99309312-99309334 TAGTAATTGATACATACTTTTGG - Intronic
977639317 4:99338096-99338118 TAGTAATTGATACATCCTTTTGG - Intronic
979159817 4:117446124-117446146 TAGCTATTGCTGCTTGCTTTTGG + Intergenic
980256581 4:130387991-130388013 TATTCATTGCTACTTGCTTTTGG + Intergenic
981074511 4:140577842-140577864 TTATCATTGGCACTTGCTATGGG - Intergenic
983072564 4:163286571-163286593 TAGTTATTCCTGCTTGCTTTTGG + Intergenic
983422209 4:167533371-167533393 TAGTCATTGGTACTTTGTTAGGG - Intergenic
985994389 5:3589353-3589375 GAGTTAGTGGTTCTTGCTTTTGG + Intergenic
988809413 5:34769703-34769725 AAGTCATTAGTCCTTGATTTTGG - Intronic
989231150 5:39087431-39087453 TAGTTATTCCTGCTTGCTTTTGG - Intergenic
992968965 5:82035646-82035668 TGGTCATTGGTATTTCTTTTAGG + Intronic
993250135 5:85511423-85511445 TAGCTATTCGTGCTTGCTTTTGG + Intergenic
994304239 5:98182563-98182585 TAGCTATTCCTACTTGCTTTTGG - Intergenic
995871843 5:116751617-116751639 TACTCAGTGGTACTTACTCTAGG + Intergenic
999576643 5:152985752-152985774 TAGTTTTTGATACTTCCTTTTGG - Intergenic
999768813 5:154759247-154759269 TAGACATTGTTACTTACTCTGGG + Intronic
1000394846 5:160762891-160762913 TAGCTATTCCTACTTGCTTTTGG - Intronic
1003357662 6:5389514-5389536 AAGTCACTTGTACTTGCGTTTGG + Intronic
1004403912 6:15313880-15313902 TAGACATTGGTAATTACCTTTGG + Intronic
1010543141 6:77117116-77117138 TAGTAAGTGGTAGTTACTTTTGG - Intergenic
1010675973 6:78743839-78743861 TAGTCATCCCTGCTTGCTTTTGG + Intergenic
1011042163 6:83041727-83041749 TAGTAATTATTAGTTGCTTTTGG - Intronic
1011206479 6:84904708-84904730 TAGTCTATGGTACTTTCTTATGG - Intergenic
1011534755 6:88364590-88364612 TAGTCATTGTTGCTTTGTTTGGG - Intergenic
1012760245 6:103292472-103292494 TAGTCTTTGTTACTTCATTTTGG - Intergenic
1014709463 6:124789476-124789498 TTGTCATTGGTACTTGGATCTGG - Intronic
1018065958 6:160125283-160125305 TGGACATTGGAACTTGCTTTAGG + Intronic
1018794730 6:167176994-167177016 TAGGCATTGGAACCTGCTTTTGG + Exonic
1018821590 6:167378073-167378095 TAGGCATTGGAACCTGCTTTTGG - Exonic
1018874442 6:167807506-167807528 TAGTGTGTGGTACTTGCATTTGG + Intergenic
1019215637 6:170441371-170441393 GAGTCATTGCTACTTGCACTGGG - Intergenic
1022580803 7:31552259-31552281 TAGTCATGGGAACATGCTTGAGG + Intronic
1023616743 7:42027906-42027928 TAATCATTCATGCTTGCTTTTGG - Intronic
1024030966 7:45459219-45459241 TAGTCATTTGTATCTCCTTTGGG + Intergenic
1024439240 7:49396632-49396654 CAGTAATTGGTGCCTGCTTTAGG - Intergenic
1025971237 7:66327833-66327855 TAGTCATTGGTACATATTTCTGG + Intronic
1026449738 7:70517325-70517347 TAGACATTGGTACATGGGTTTGG + Intronic
1027293406 7:76740725-76740747 TGGTCATTTGTAATTGCTTCTGG + Intergenic
1028123488 7:87084566-87084588 TAGTCATTTGATCTTACTTTTGG - Intergenic
1028316605 7:89409932-89409954 TAGTCAGTGGTATTTTCTTTTGG - Intergenic
1028703086 7:93806043-93806065 TTGCCATTGGTTCTTGTTTTCGG - Intronic
1036833575 8:12040320-12040342 TAGTCCTTGGTCCGTGGTTTGGG + Intergenic
1036855422 8:12286885-12286907 TAGTCCTTGGTCCGTGGTTTGGG + Intergenic
1038506106 8:28086497-28086519 TAGTCCTTGGCACCTGCTATTGG + Intergenic
1040946638 8:52891995-52892017 TAGTCTGTGGTACTTTGTTTTGG + Intergenic
1041877155 8:62702555-62702577 TAGTCATTGGTATTTACCCTTGG - Intronic
1042193483 8:66211770-66211792 TAGTCATTGCTGCTTGATTTTGG - Intergenic
1043724445 8:83591551-83591573 TATTGCTTGGTATTTGCTTTTGG - Intergenic
1044065279 8:87690989-87691011 AAGTGATTGGTAATTCCTTTTGG + Intergenic
1044509878 8:93062589-93062611 TAGTCATTACTACTCTCTTTTGG - Intergenic
1046638790 8:116702750-116702772 TTGTTATTCGTACTTGATTTTGG - Intronic
1049635525 8:143686395-143686417 TGGTCATTGCTACTTGCTAGAGG + Intronic
1051210532 9:14737606-14737628 AAGTAATTGGTACATTCTTTTGG - Intronic
1053105198 9:35403061-35403083 TGGTGATTGCTTCTTGCTTTTGG + Intronic
1055269114 9:74535856-74535878 CAGTCATTTGTACTTACATTTGG - Intronic
1055304316 9:74913089-74913111 TAGTTATTCCTGCTTGCTTTTGG - Intergenic
1055798202 9:79999417-79999439 CAGACATTGGCAATTGCTTTGGG + Intergenic
1056732097 9:89175037-89175059 TACTCATTGGTATTTCTTTTAGG + Intronic
1056732100 9:89175101-89175123 TAGTCATTGTTCTTTGCTGTTGG + Intronic
1060575711 9:124691387-124691409 TAGTTATTACTATTTGCTTTAGG - Intronic
1185871479 X:3668472-3668494 TTGTCATTGGTACTTGTTGGGGG - Intronic
1187030831 X:15486516-15486538 TACTGAGTGGTACTTGTTTTAGG + Intronic
1188132203 X:26450353-26450375 TTGGCATTGGTATATGCTTTTGG - Intergenic
1190001658 X:46694449-46694471 TAGTCATTCATAATTTCTTTTGG - Intronic
1190792724 X:53715015-53715037 TAGTCATTGCTACCTCATTTGGG + Intergenic
1191214707 X:57922524-57922546 TAGTCCTTGGTCCTTGGCTTGGG - Intergenic
1191893809 X:65972073-65972095 TAGTAATTTGTAATTGCTTCAGG + Intergenic
1194232162 X:91337627-91337649 TAGCTACTTGTACTTGCTTTTGG - Intergenic
1197003187 X:121463620-121463642 TTGATATTGTTACTTGCTTTTGG + Intergenic
1197981472 X:132221763-132221785 TAGTGATTGTTACTTGCTTTAGG + Intergenic