ID: 1124272984

View in Genome Browser
Species Human (GRCh38)
Location 15:28300155-28300177
Sequence CTACCTACGGGGAAATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 4, 1: 0, 2: 1, 3: 4, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124272976_1124272984 -3 Left 1124272976 15:28300135-28300157 CCAAAAGCAAGTACCAATGACTA 0: 4
1: 0
2: 2
3: 15
4: 142
Right 1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG 0: 4
1: 0
2: 1
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124272984 Original CRISPR CTACCTACGGGGAAATGGGG AGG Intronic
901383288 1:8889483-8889505 CTTCCTACGGGGACTTGGGGAGG - Intergenic
902579433 1:17398952-17398974 GTACCTATGAGGAAATGGGAGGG + Intronic
907043779 1:51286752-51286774 TTCCCTACGGGGAAATGGTTAGG + Intergenic
907632176 1:56093673-56093695 TTACCTGAGGGGAAATGGGCTGG - Intergenic
916492760 1:165316299-165316321 CTTACCACGGGGAGATGGGGAGG + Intronic
924434583 1:244027804-244027826 CCACCTAAGGGAAAGTGGGGTGG + Intergenic
1063758871 10:9048481-9048503 CTACCAAAAGGGAAATGTGGAGG - Intergenic
1069825569 10:71253265-71253287 CAAGCTACGGGGAAAGGAGGTGG - Intronic
1071525553 10:86355968-86355990 CCAGCTACGGGGACAGGGGGAGG + Intronic
1076812832 10:132898207-132898229 CTCCCTGCTGGGAGATGGGGAGG - Intronic
1077300241 11:1843341-1843363 GTGCCTACTGGGAAAGGGGGCGG + Intergenic
1080074591 11:28134371-28134393 ATACGCACGGGGGAATGGGGTGG - Intronic
1082962778 11:58934827-58934849 CTGCCAACCTGGAAATGGGGTGG + Intronic
1083812103 11:65111935-65111957 CCATCTCCTGGGAAATGGGGCGG + Exonic
1084409322 11:68997254-68997276 CTGCCTACGGAGGGATGGGGAGG + Intergenic
1085486364 11:76866887-76866909 CTACATAAAGGGAAATGGAGGGG + Intronic
1085518115 11:77123007-77123029 CCCCCCACGGGGAAATGGGAGGG - Intronic
1092839737 12:12528303-12528325 CTACCTACTGGGAGAGGGGCCGG + Intronic
1096749450 12:53749403-53749425 CAGACTAAGGGGAAATGGGGAGG + Intergenic
1103336207 12:120191954-120191976 CTTCCACTGGGGAAATGGGGAGG - Intronic
1104377789 12:128280097-128280119 CTACATACATGAAAATGGGGAGG + Intronic
1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG + Intronic
1107189367 13:37560848-37560870 CTACATAAGGAGAAATGAGGAGG + Intergenic
1107200043 13:37704194-37704216 TTGCCTACGGGGGAATGGGGAGG + Intronic
1111976068 13:94968205-94968227 CGTCCTGCGGGGAACTGGGGTGG - Intergenic
1115582813 14:34778220-34778242 CTAGCTAGGTGGAAATGGGAAGG - Intronic
1119780831 14:77275897-77275919 CTACCTACTGGGTGGTGGGGAGG - Exonic
1120731191 14:88003100-88003122 CTACTCATGGGGTAATGGGGAGG - Intergenic
1122159136 14:99770077-99770099 CTATCTTAGGGGAAATGGGGGGG - Intronic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1126205299 15:46038500-46038522 CTCCCTATGGGGAAAATGGGTGG - Intergenic
1132199977 15:99944628-99944650 ATCCCAACTGGGAAATGGGGTGG + Intergenic
1132844489 16:1993501-1993523 CTACCCACAGGGACATGGGATGG - Exonic
1137282805 16:46992557-46992579 CCACCAACGTGGAAGTGGGGGGG + Intergenic
1138158997 16:54735757-54735779 CGACCTACAGGGAAGGGGGGTGG - Intergenic
1146884765 17:36463757-36463779 CTACCTATGGGGTGGTGGGGGGG - Intergenic
1148859129 17:50594974-50594996 TTTCCTACAGGGAAAGGGGGAGG - Exonic
1149063535 17:52453178-52453200 GAACCTACCAGGAAATGGGGTGG - Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1152382329 17:79948550-79948572 CCACCCACGGGGAGATGGAGGGG + Intronic
1162343171 19:10104751-10104773 CAACTTAAAGGGAAATGGGGTGG + Intergenic
1162727911 19:12701030-12701052 CTACAAACGGGGAGGTGGGGGGG - Exonic
931748705 2:65312654-65312676 CTACTTTAGGGGTAATGGGGAGG + Exonic
932810032 2:74817500-74817522 CTTGCTAAGGGGAAGTGGGGCGG - Intergenic
942372513 2:175300460-175300482 CTACCTACAGAGAAGTGGGAGGG - Intergenic
947068740 2:226261728-226261750 CTACTGACGGTGAAAAGGGGAGG + Intergenic
947168435 2:227286553-227286575 TTACATACGGGGAAATAGGGAGG + Intronic
1182383341 22:29912641-29912663 TTACCTCCAGGCAAATGGGGTGG - Intronic
951243892 3:20317747-20317769 CAACCTACGGGGAAATGAGGGGG - Intergenic
951359297 3:21705548-21705570 CTACCTACGTGGGCATGGGAAGG + Intronic
954389581 3:50261584-50261606 CTACCTGCTGGGACAGGGGGTGG - Intergenic
956064533 3:65383267-65383289 CTCCCTTGGGGGAAAAGGGGTGG + Intronic
959358974 3:105366813-105366835 CTGCGTCCGGGGAAGTGGGGAGG + Intergenic
962231377 3:133668553-133668575 CTACACACTGGGGAATGGGGAGG - Intergenic
992901587 5:81301953-81301975 CTACGTACGTGGGAAGGGGGAGG - Exonic
1003681337 6:8260380-8260402 CTAATCACTGGGAAATGGGGTGG + Intergenic
1005996113 6:30932378-30932400 CTACAGACAGGGAAATGGAGAGG + Intergenic
1009543087 6:64990089-64990111 CTACCTACAGACAAATGAGGTGG + Intronic
1021926705 7:25540801-25540823 CTAGCCATGGGGAGATGGGGAGG + Intergenic
1027793568 7:82662325-82662347 GTTCCTGGGGGGAAATGGGGAGG + Intergenic
1032758945 7:134919621-134919643 CTATGTATGGGGAGATGGGGTGG + Intronic
1034301849 7:150023040-150023062 TAACCTTCGGGGAAATAGGGTGG - Intergenic
1034804196 7:154074221-154074243 TAACCTTCGGGGAAATAGGGTGG + Intronic
1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG + Intergenic
1054901710 9:70375854-70375876 CTACCTACAGGTAAATGAGAAGG + Intergenic
1055080641 9:72265075-72265097 CTACCTCAGGGGAGATGGGTGGG + Intergenic
1056094903 9:83242951-83242973 TTATCTACTGGGAACTGGGGTGG - Intergenic
1060282333 9:122222861-122222883 CTCCCAACGGGGCAAGGGGGAGG - Intronic
1189786911 X:44567156-44567178 CTACATACGGGGAAGGGTGGAGG + Intergenic
1199393660 X:147309529-147309551 CTACCTATGGGTAAGTGGTGAGG + Intergenic