ID: 1124276777

View in Genome Browser
Species Human (GRCh38)
Location 15:28332803-28332825
Sequence TCCTGGAGCAGGGTTTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124276777_1124276785 3 Left 1124276777 15:28332803-28332825 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1124276785 15:28332829-28332851 TCCAGTCTTTTGGTTTCCCTGGG No data
1124276777_1124276792 30 Left 1124276777 15:28332803-28332825 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1124276792 15:28332856-28332878 ACTGGAAGAAGAATTGTCTTGGG No data
1124276777_1124276791 29 Left 1124276777 15:28332803-28332825 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1124276791 15:28332855-28332877 CACTGGAAGAAGAATTGTCTTGG No data
1124276777_1124276782 -7 Left 1124276777 15:28332803-28332825 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1124276782 15:28332819-28332841 TCCAGGAGGGTCCAGTCTTTTGG No data
1124276777_1124276784 2 Left 1124276777 15:28332803-28332825 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1124276784 15:28332828-28332850 GTCCAGTCTTTTGGTTTCCCTGG No data
1124276777_1124276787 12 Left 1124276777 15:28332803-28332825 CCTGTGAAAACCCTGCTCCAGGA No data
Right 1124276787 15:28332838-28332860 TTGGTTTCCCTGGGCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124276777 Original CRISPR TCCTGGAGCAGGGTTTTCAC AGG (reversed) Intergenic