ID: 1124279292

View in Genome Browser
Species Human (GRCh38)
Location 15:28349672-28349694
Sequence GTTGCAGGAGACCCGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124279292_1124279299 -4 Left 1124279292 15:28349672-28349694 CCCTCAACCGGGTCTCCTGCAAC No data
Right 1124279299 15:28349691-28349713 CAACTATCGGTGGGCCATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124279292 Original CRISPR GTTGCAGGAGACCCGGTTGA GGG (reversed) Intergenic
No off target data available for this crispr