ID: 1124282744

View in Genome Browser
Species Human (GRCh38)
Location 15:28378466-28378488
Sequence CTCCCCTCTCTTAGAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 12, 1: 5, 2: 6, 3: 36, 4: 270}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124282736_1124282744 1 Left 1124282736 15:28378442-28378464 CCCCTCTCCCAGAGTTGGCGGCC 0: 6
1: 6
2: 6
3: 19
4: 170
Right 1124282744 15:28378466-28378488 CTCCCCTCTCTTAGAGTGGGTGG 0: 12
1: 5
2: 6
3: 36
4: 270
1124282739_1124282744 -6 Left 1124282739 15:28378449-28378471 CCCAGAGTTGGCGGCCTCTCCCC 0: 6
1: 1
2: 6
3: 18
4: 113
Right 1124282744 15:28378466-28378488 CTCCCCTCTCTTAGAGTGGGTGG 0: 12
1: 5
2: 6
3: 36
4: 270
1124282734_1124282744 5 Left 1124282734 15:28378438-28378460 CCTGCCCCTCTCCCAGAGTTGGC No data
Right 1124282744 15:28378466-28378488 CTCCCCTCTCTTAGAGTGGGTGG 0: 12
1: 5
2: 6
3: 36
4: 270
1124282738_1124282744 -1 Left 1124282738 15:28378444-28378466 CCTCTCCCAGAGTTGGCGGCCTC 0: 6
1: 1
2: 6
3: 15
4: 146
Right 1124282744 15:28378466-28378488 CTCCCCTCTCTTAGAGTGGGTGG 0: 12
1: 5
2: 6
3: 36
4: 270
1124282731_1124282744 10 Left 1124282731 15:28378433-28378455 CCGGCCCTGCCCCTCTCCCAGAG No data
Right 1124282744 15:28378466-28378488 CTCCCCTCTCTTAGAGTGGGTGG 0: 12
1: 5
2: 6
3: 36
4: 270
1124282732_1124282744 6 Left 1124282732 15:28378437-28378459 CCCTGCCCCTCTCCCAGAGTTGG No data
Right 1124282744 15:28378466-28378488 CTCCCCTCTCTTAGAGTGGGTGG 0: 12
1: 5
2: 6
3: 36
4: 270
1124282740_1124282744 -7 Left 1124282740 15:28378450-28378472 CCAGAGTTGGCGGCCTCTCCCCT 0: 6
1: 1
2: 18
3: 22
4: 153
Right 1124282744 15:28378466-28378488 CTCCCCTCTCTTAGAGTGGGTGG 0: 12
1: 5
2: 6
3: 36
4: 270
1124282737_1124282744 0 Left 1124282737 15:28378443-28378465 CCCTCTCCCAGAGTTGGCGGCCT 0: 6
1: 1
2: 6
3: 16
4: 158
Right 1124282744 15:28378466-28378488 CTCCCCTCTCTTAGAGTGGGTGG 0: 12
1: 5
2: 6
3: 36
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124282744 Original CRISPR CTCCCCTCTCTTAGAGTGGG TGG Intergenic
900013876 1:136265-136287 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900013900 1:136362-136384 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900013924 1:136459-136481 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900013948 1:136557-136579 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014003 1:136752-136774 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014017 1:136801-136823 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014031 1:136850-136872 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014060 1:136948-136970 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014084 1:137045-137067 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014108 1:137143-137165 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014132 1:137240-137262 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900043946 1:492248-492270 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900043995 1:492442-492464 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900065405 1:727348-727370 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
901381926 1:8879759-8879781 CAGCCCTCCCTTGGAGTGGGGGG - Intergenic
901523268 1:9802024-9802046 TACCCCTCTCACAGAGTGGGTGG - Intronic
903467023 1:23558906-23558928 ATCTCCTCTCTTGGAGAGGGAGG - Intronic
903679428 1:25087394-25087416 CACCCCTCTCTGAGCCTGGGAGG + Intergenic
903835711 1:26202108-26202130 CTACCCTTTCTTAGTGTGTGTGG + Intronic
910262087 1:85302705-85302727 CTACCCACTCTTTGAGGGGGAGG + Intergenic
914879637 1:151537593-151537615 CTCATCTCTCTTATAGTGGAAGG + Exonic
916658295 1:166897553-166897575 CTCCCCTCCCTAAGGTTGGGAGG - Intergenic
918238810 1:182604158-182604180 CTCCACTCCCTAAGAGTTGGTGG + Intronic
918948017 1:191095091-191095113 CTGACCTCTGTTACAGTGGGAGG + Intergenic
919584752 1:199422460-199422482 CACCTGTCTCTAAGAGTGGGTGG + Intergenic
922734742 1:227972974-227972996 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1065878054 10:30014063-30014085 CTCCCCCTTCTTAGTGTGGTGGG + Exonic
1065919009 10:30374626-30374648 CTCCCCTCTCCCAGAGTGGGTGG - Intergenic
1066252957 10:33651995-33652017 CTTCCCTCTCAAAGGGTGGGAGG - Intergenic
1066732676 10:38449383-38449405 CTGACCTCTCTCAGTGTGGGAGG - Intergenic
1066732697 10:38449480-38449502 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1069755664 10:70773162-70773184 CTCTGCTCTCTCAGAGTGGAAGG + Intronic
1073475755 10:103752017-103752039 CTCCCCTCTCTAGGTTTGGGAGG - Intronic
1074419627 10:113297728-113297750 TTCCTCTCTCTGAGAGTGGCTGG - Intergenic
1075082056 10:119390934-119390956 CTCGCCTCTCTCAGAGGGAGGGG - Intronic
1076970208 11:128431-128453 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1076970234 11:128528-128550 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1076970258 11:128626-128648 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1076970282 11:128723-128745 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1076970306 11:128820-128842 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1076970332 11:128917-128939 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1079258270 11:18852168-18852190 CTCTCCTCTCTTCAAGTGGAAGG - Intergenic
1080337108 11:31210211-31210233 CTACCTTCTCTTTGCGTGGGAGG - Intronic
1081789252 11:45771441-45771463 CTCCCCTCTCTAAGCGTCCGCGG - Exonic
1081864500 11:46352220-46352242 CTCTCCTGCCTTAAAGTGGGTGG - Intronic
1083374644 11:62209571-62209593 TTCCTCTCCCTTACAGTGGGAGG + Intronic
1084517865 11:69646236-69646258 CTCCCGGCTCTCAGACTGGGTGG + Intronic
1085458898 11:76681339-76681361 CTACACTCTCATAGAATGGGAGG - Intergenic
1091714549 12:2767676-2767698 CTCCCGTCTCTTCTTGTGGGTGG - Intergenic
1094451285 12:30585404-30585426 CTCCCCTCTCTTACAGGTTGGGG - Intergenic
1095597186 12:43972271-43972293 ATCTCATCTCTTAGTGTGGGGGG + Intronic
1102030230 12:109736094-109736116 CTCCCCGCTCTGAGGTTGGGGGG + Intronic
1102680246 12:114686005-114686027 CTCCCCTATCTCAGCGTGGTTGG - Intergenic
1105282585 13:18976990-18977012 CTCCCCTCTCTTGCAGTCTGTGG + Intergenic
1106855397 13:33846508-33846530 CTCCCCTCTCCTCAAGTGGAGGG + Intronic
1107822752 13:44301032-44301054 CTCCCCACTCGTAGTGTGTGAGG - Intergenic
1110799496 13:79678583-79678605 CTCCACTCTCAAAGTGTGGGTGG + Intergenic
1115948597 14:38694292-38694314 CTCTCCTCTCCTCGAGTGGAGGG - Intergenic
1117528170 14:56632372-56632394 CTCCCCTCTCTCAGAGTTTTGGG + Intronic
1121291339 14:92778231-92778253 CTCACCTCTCTTAGAGATGTTGG + Intergenic
1121530996 14:94653503-94653525 TTCCCCTCTCTAACATTGGGTGG - Intergenic
1123469905 15:20541942-20541964 CGCCCCTCTCCTGGAGTGGGCGG - Intergenic
1123471936 15:20562177-20562199 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1123646068 15:22438176-22438198 CTCCCCTCTCTTAGGGTGGGTGG - Intergenic
1123648150 15:22458739-22458761 CGCCCCTCTCCTGGAGTGGGCGG + Intergenic
1123683075 15:22776298-22776320 CGCCTCTCTCCCAGAGTGGGCGG - Intronic
1123730199 15:23136964-23136986 CGCCCCTCTCCTGGAGTGGGCGG - Intergenic
1123732239 15:23157168-23157190 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1123748337 15:23334374-23334396 CGCCCCTCTCCTGGAGTGGGCGG - Intergenic
1123750374 15:23354550-23354572 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1123763106 15:23447421-23447443 CGCCCCTCTCCTGGAGTGGGCGG - Intergenic
1124280715 15:28358261-28358283 CGCCCCTCTCCTGGAGTGGGCGG - Intergenic
1124282744 15:28378466-28378488 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124299956 15:28533147-28533169 CTCCCCTCTCTTAGGGTGGGTGG - Intergenic
1124301989 15:28553368-28553390 CGCCCCTCTCCTGGAGTGGGCGG + Intergenic
1124334833 15:28848822-28848844 CGCCCCTCTCCCAGAGTGGGCGG - Intergenic
1124481282 15:30082755-30082777 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124487737 15:30134851-30134873 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124522317 15:30414438-30414460 CTCCCCTCTCTTAGAGTGGGTGG - Intergenic
1124536347 15:30551780-30551802 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124542826 15:30603828-30603850 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124562782 15:30791278-30791300 CTCCCCTCTCACAGAGTGGGCGG + Intergenic
1124755792 15:32403470-32403492 CTCCCCTCTCTTAGAGTGGGTGG - Intergenic
1124762304 15:32455812-32455834 CTCCCCTCTCTTAGAGTGGGTGG - Intergenic
1124776327 15:32593258-32593280 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124960528 15:34389966-34389988 CTCCCCTCTCTCAGAGTGGGTGG - Intronic
1124960537 15:34389992-34390014 CTCCACTCTCCCAGAGCGGGCGG - Intronic
1124977157 15:34536187-34536209 CTCCCCTCTCTCAGAGTGGGTGG - Intronic
1124977166 15:34536213-34536235 CTCCACTCTCCCAGAGCGGGCGG - Intronic
1127634968 15:60860271-60860293 CTGCACTCTCTTGGATTGGGTGG - Intronic
1127866396 15:63036784-63036806 CTCCCATCACTGAGAGTGGGTGG + Intergenic
1129028957 15:72604923-72604945 CTCCCCTCTCCCAGAGTGGGAGG + Intergenic
1129838142 15:78726885-78726907 CTCCCCTCTCCTGGAGTGGGCGG + Intronic
1130260435 15:82349614-82349636 CTCCCCTTTCTCTGAGTGGGCGG - Intergenic
1130260446 15:82349640-82349662 TTCCCCTCTCCCAGAGTGGGCGG - Intergenic
1130268286 15:82429793-82429815 CTCCCCTCTCCCAGAGTGGGCGG + Intergenic
1130268295 15:82429819-82429841 CTCCCCTCTCTCTGAGTGGGCGG + Intergenic
1130280786 15:82519364-82519386 TTCCCCTCTCCCAGAGTGGGCGG + Intergenic
1130280797 15:82519390-82519412 CTCCCCTTTCTCTGAGTGGGCGG + Intergenic
1130472157 15:84235547-84235569 TTCCCCTCTCCCAGAGTGGGCGG + Intergenic
1130472168 15:84235573-84235595 CTCCCCTTTCTCTGAGTGGGCGG + Intergenic
1130479650 15:84350118-84350140 TTCCCCTCTCCCAGAGTGGGCGG + Intergenic
1130479661 15:84350144-84350166 CTCCCCTTTCTCTGAGTGGGCGG + Intergenic
1130492109 15:84437985-84438007 CTCCCCTTTCTCTGAGTGGGCGG - Intergenic
1130492120 15:84438011-84438033 TTCCCCTCTCCCAGAGTGGGCGG - Intergenic
1130503737 15:84517047-84517069 TTCCCCTCTCCCAGAGTGGGTGG - Intergenic
1130594457 15:85240184-85240206 TTCTCCTCTCCCAGAGTGGGCGG + Intergenic
1130594466 15:85240210-85240232 CTCCCCTTTCTCTGAGTGGGCGG + Intergenic
1130936164 15:88472634-88472656 CTCTCCTCTCCTGGAATGGGAGG - Exonic
1131944860 15:97608800-97608822 CTCTCCTCTCTTCAAGTGGAAGG - Intergenic
1132184287 15:99790843-99790865 CTCCCCTCTCCCAGAGGGGGCGG + Intergenic
1132434078 15:101782281-101782303 CTCCACTCTCTTAGAGTGGGCGG - Intergenic
1132434088 15:101782307-101782329 CTCCCCTGTCCCAGAGTGGGTGG - Intergenic
1132724054 16:1331230-1331252 CTGCCCTCTCTCTTAGTGGGAGG + Intergenic
1133279522 16:4657281-4657303 CACCCCTCTCTTGTAGTGGACGG - Exonic
1136069866 16:27781262-27781284 ATTCCCTCTGTGAGAGTGGGAGG + Intergenic
1136119950 16:28126335-28126357 CTCTCCTCTCTTAGCAGGGGCGG - Intronic
1136773034 16:32857896-32857918 CTCGCCTCGCTGCGAGTGGGTGG + Intergenic
1136897581 16:34003623-34003645 CTCGCCTCGCTGCGAGTGGGTGG - Intergenic
1138277556 16:55747040-55747062 CTCACATATGTTAGAGTGGGAGG - Intergenic
1138283537 16:55790825-55790847 CTCACATGTGTTAGAGTGGGAGG - Intergenic
1138285465 16:55806162-55806184 CTCACATGTGTTAGAGTGGGAGG + Intronic
1139047614 16:63081802-63081824 TTCCCCACTTTTAGAGTGTGTGG + Intergenic
1142449917 16:90168565-90168587 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142449941 16:90168662-90168684 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142449967 16:90168759-90168781 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142449991 16:90168856-90168878 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450028 16:90169001-90169023 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450040 16:90169049-90169071 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450051 16:90169097-90169119 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450065 16:90169146-90169168 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450077 16:90169194-90169216 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450090 16:90169243-90169265 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450101 16:90169291-90169313 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450115 16:90169340-90169362 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450127 16:90169388-90169410 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450141 16:90169437-90169459 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450152 16:90169486-90169508 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450164 16:90169534-90169556 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450191 16:90169632-90169654 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450203 16:90169680-90169702 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450217 16:90169729-90169751 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450241 16:90169826-90169848 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450253 16:90169874-90169896 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450280 16:90169972-90169994 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450292 16:90170020-90170042 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450304 16:90170069-90170091 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450317 16:90170118-90170140 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450331 16:90170167-90170189 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450355 16:90170264-90170286 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450367 16:90170312-90170334 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450394 16:90170410-90170432 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450406 16:90170458-90170480 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450433 16:90170556-90170578 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450445 16:90170604-90170626 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450457 16:90170653-90170675 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203075459 16_KI270728v1_random:1120006-1120028 CTCGCCTCGCTGCGAGTGGGTGG + Intergenic
1142457105 17:63038-63060 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1142457129 17:63135-63157 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1142457167 17:63281-63303 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1144557486 17:16294896-16294918 GTCCCCTATCTTAGAGGTGGTGG + Intronic
1146650287 17:34602194-34602216 CTGTCCTCTCCTAGACTGGGAGG - Intronic
1148113487 17:45161264-45161286 CTCGCCTCTCACAGAGTGCGGGG - Intronic
1149437897 17:56649540-56649562 GTCCTCTATCTTTGAGTGGGAGG + Intergenic
1149483528 17:57023170-57023192 CTCCCCTCCCCTAGAGATGGGGG - Intergenic
1151251744 17:72841100-72841122 CCCTCCTCTCTTAGAATGGAGGG + Intronic
1152578840 17:81157153-81157175 CTCCCCTCTCTTGGCGGGGGCGG - Intronic
1157748972 18:50161418-50161440 CTCCCCTCTAAGGGAGTGGGGGG + Intronic
1159267396 18:66100286-66100308 CTCCCTTATCTTTGAGTGGAAGG - Intergenic
1159596436 18:70386909-70386931 CTCTCCTCCCATAGAGTGGCAGG - Intergenic
1160647018 19:198397-198419 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647042 19:198494-198516 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647068 19:198591-198613 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647094 19:198688-198710 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647118 19:198785-198807 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647144 19:198882-198904 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647170 19:198979-199001 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647194 19:199076-199098 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647218 19:199170-199192 CACACCTCTCTCAGCGTGGGAGG + Intergenic
1160647232 19:199219-199241 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647243 19:199268-199290 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647254 19:199316-199338 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647280 19:199413-199435 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647306 19:199510-199532 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647330 19:199607-199629 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647393 19:199851-199873 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647418 19:199948-199970 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647442 19:200045-200067 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647466 19:200142-200164 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647490 19:200239-200261 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647514 19:200337-200359 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647526 19:200386-200408 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160968067 19:1755271-1755293 CTCCCCTCCTCCAGAGTGGGTGG + Intronic
1161955739 19:7493880-7493902 CTCCCCTCTCCCCCAGTGGGGGG + Intronic
1167742335 19:51331260-51331282 CTTCCCTCTCATGGGGTGGGAGG - Intergenic
1168615490 19:57833928-57833950 CTCTCCTCTCCTCGAGTGGAAGG + Intronic
1168621295 19:57881519-57881541 CTCTCCTCTCCTCGAGTGGAAGG - Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
1168694045 19:58395200-58395222 CACCCCCCTCTTGGAGTGTGGGG + Intergenic
930104940 2:47632228-47632250 CTTCCCTCTCCTAGAGAGGCTGG - Intergenic
930872614 2:56184143-56184165 CTCCCCTCTCCTAGCTTGGAGGG - Exonic
931462122 2:62458193-62458215 ATCCCATCTCTTAGTCTGGGCGG + Intergenic
931642350 2:64392973-64392995 CCCTCCTCACTTGGAGTGGGAGG - Intergenic
932322353 2:70831576-70831598 CTTCCCTGTCTTAGAGTGACAGG - Intronic
932781429 2:74560962-74560984 CTCCCCAGGCTAAGAGTGGGAGG - Intronic
946249939 2:218405809-218405831 CTCCCCTCCCCCAGAGCGGGTGG + Exonic
1168847393 20:954839-954861 CACCTCTCTCCTAGAGTGGGAGG - Intergenic
1170869727 20:20194691-20194713 CGCCCCTCTTTTTGATTGGGAGG + Intronic
1174285967 20:49473835-49473857 CTCACCTCTCTGAGACTGGGAGG - Intronic
1177097977 21:16862195-16862217 CTCTACTCTCTGAGAGTGAGTGG - Intergenic
1178684504 21:34700673-34700695 ATTCCCTCTCTTCGAGGGGGTGG + Intronic
1179133852 21:38661861-38661883 CTCCCTTCCCTTGGGGTGGGGGG - Intergenic
1180244296 21:46536452-46536474 CTCCCCTCTGTAAGAGCTGGTGG - Intronic
1181631706 22:24155111-24155133 CTCCCCTCAGCTGGAGTGGGAGG + Intronic
1184178106 22:42801295-42801317 CTCCCCTCTCTGAGACAGAGGGG + Intronic
950132120 3:10554408-10554430 CTCCCCTGTCTTAAAGTCAGCGG - Intronic
950578136 3:13845291-13845313 CATCACTCTCTTAGAGTGGCGGG - Intronic
951367280 3:21798704-21798726 CTCCCCCTTCTTTGAGTGGCTGG - Intronic
952322313 3:32289518-32289540 CTCCCCTCTCCTAGCCTGGAAGG - Intronic
960089795 3:113627710-113627732 CTCCCCTCTCTTAATGTTGGAGG - Exonic
961584938 3:127914799-127914821 TACACCTCTCTGAGAGTGGGAGG - Intergenic
962038832 3:131683527-131683549 CTCTCCTCTCCTCAAGTGGGAGG + Intronic
964405075 3:156340363-156340385 TACACCTCTCTTCGAGTGGGAGG + Intronic
964826976 3:160839358-160839380 TTCCCATCTCTAGGAGTGGGTGG + Intronic
965639108 3:170814180-170814202 CTCCCTTCTCTAAGAATGGCTGG - Intronic
967463946 3:189780633-189780655 CACCCCACACTTAGAGTGAGTGG + Intronic
968370327 3:198219818-198219840 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370351 3:198219915-198219937 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370376 3:198220012-198220034 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370425 3:198220205-198220227 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370452 3:198220303-198220325 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370476 3:198220400-198220422 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370500 3:198220497-198220519 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370514 3:198220546-198220568 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370525 3:198220595-198220617 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370539 3:198220644-198220666 CACACCTCTCTCAGCGTGGGAGG - Intergenic
968370563 3:198220738-198220760 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370614 3:198220932-198220954 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370640 3:198221029-198221051 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370664 3:198221126-198221148 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968474070 4:794950-794972 CTCCACACTCTCAGAGCGGGAGG - Intronic
973108631 4:46372822-46372844 CCCCACCCTCTTAGAGAGGGTGG - Intronic
973725328 4:53770008-53770030 CTCCCATCTCTCAGAGGGGCTGG + Intronic
980897760 4:138876057-138876079 CTTCCCTCTCCTAAAGTGTGTGG - Intergenic
985791873 5:1932853-1932875 CTCCCATCTGTTGGAGTTGGTGG + Intergenic
986393680 5:7306832-7306854 CGCCCCTCTCCCAGAGTGGGCGG - Intergenic
991103290 5:62817170-62817192 TTCCCCTCTCCTATAGTGGAAGG + Intergenic
992457016 5:76925269-76925291 CTCCCCTCCCATAGAGTGCTAGG - Intergenic
992626557 5:78641047-78641069 CTTCCCTGCCTTAGAGAGGGTGG - Intronic
992672891 5:79077128-79077150 CTCCCCTGTTTTTGTGTGGGGGG - Intronic
996161570 5:120173445-120173467 CTCTCCTCTCTTCAAGTGGAAGG - Intergenic
997002985 5:129784480-129784502 CTCTCCTCTCCTCGAGTGGAAGG - Intergenic
997367578 5:133335670-133335692 CTCCCCTTTCTTGGGGGGGGTGG + Intronic
997439112 5:133896746-133896768 CTCCTGCCTCTGAGAGTGGGTGG - Intergenic
999213543 5:149912351-149912373 TTCCCCTCTGTTAGTGTGGATGG + Intronic
1000450837 5:161384841-161384863 ATCCCCATTCTTAGAGTTGGGGG + Intronic
1001229164 5:169970962-169970984 CTCCCCTGTCTTGGAGAGGATGG - Intronic
1002729848 5:181326487-181326509 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1002729872 5:181326584-181326606 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1002729897 5:181326681-181326703 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1003964072 6:11236561-11236583 CTGCCCTCTCTATGAGTGGCTGG - Intronic
1007257482 6:40539025-40539047 GTCCTCTGTCTTAGAGAGGGAGG - Intronic
1007276274 6:40676454-40676476 CTCTCCCCTCTCAGACTGGGTGG + Intergenic
1007770276 6:44186484-44186506 CTGCCATCTCTTAGAGAGAGAGG - Intergenic
1008177674 6:48288511-48288533 CTCTCCTCTCCTAAAGTGGAAGG + Intergenic
1010207906 6:73339360-73339382 GACCCCTCTCTTAGCTTGGGAGG - Intergenic
1014712771 6:124827551-124827573 CTTTCCTTTCTTGGAGTGGGTGG - Intergenic
1018737892 6:166702554-166702576 CCCTCCTCACTTACAGTGGGAGG - Intronic
1022741194 7:33123146-33123168 CTCTCCTCTCCTAAAGTGGAAGG + Intergenic
1023622513 7:42087469-42087491 CTGCCCTGTCTTAGAGGTGGTGG - Intronic
1024648560 7:51387508-51387530 CTGACCTCTCTCAGTGTGGGAGG + Intergenic
1024927541 7:54633216-54633238 ATCCCCTCTGTGAGTGTGGGTGG - Intergenic
1025129648 7:56368741-56368763 CGGCCCTCTCTCAGCGTGGGAGG + Intergenic
1025129751 7:56369160-56369182 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1027234380 7:76289336-76289358 TTTCTCTCTCTTAGAGTGGTGGG + Intergenic
1028088913 7:86672857-86672879 CTCCCCTCTCTATGAGTGTGTGG + Intronic
1028840250 7:95421678-95421700 CTCCCCTCCCCTAGACTGGTTGG - Intronic
1029530768 7:101123761-101123783 GTCCCCACTCATAGATTGGGTGG - Intergenic
1030391340 7:108931819-108931841 CTCTCCTCTCTTTGAGTGGAAGG + Intergenic
1032051579 7:128653653-128653675 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1035921708 8:3683498-3683520 CTCCTCTCACTTGGAGGGGGAGG + Intronic
1040979004 8:53226320-53226342 CTCCTCCCAGTTAGAGTGGGGGG + Exonic
1046775330 8:118158445-118158467 CTCCCCTCTTTCTGAGTTGGAGG + Intergenic
1048427259 8:134334269-134334291 CTCCCCTATCTTCTAATGGGAGG + Intergenic
1050420763 9:5462981-5463003 CTCCTCTCTCTTGGAATTGGTGG - Exonic
1051008272 9:12376958-12376980 CTGCCCTCTCCAATAGTGGGTGG - Intergenic
1051991133 9:23153855-23153877 CTCGCCTCTCTTTAAGTGGAAGG + Intergenic
1052023801 9:23553457-23553479 CTCTCCTCTCTTAGAGGCAGTGG - Intergenic
1052966753 9:34346156-34346178 CTCCGCACTCTCAGAATGGGAGG + Intergenic
1053044802 9:34906712-34906734 CTCCCTGCACTTTGAGTGGGGGG - Intergenic
1055073919 9:72194513-72194535 CTCTCCTCTCCTCGAGTGGAAGG + Intronic
1056681264 9:88721143-88721165 CTCTCCTCCCCCAGAGTGGGTGG + Intergenic
1056691661 9:88813315-88813337 CTCCCCTCTCACTGGGTGGGCGG + Intergenic
1057843756 9:98506423-98506445 CTCCTCCATCTAAGAGTGGGTGG - Intronic
1062754275 9:138279048-138279070 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1062754300 9:138279146-138279168 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1062754312 9:138279195-138279217 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203577822 Un_KI270745v1:21756-21778 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203577845 Un_KI270745v1:21853-21875 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203577919 Un_KI270745v1:22142-22164 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203577940 Un_KI270745v1:22239-22261 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203577963 Un_KI270745v1:22336-22358 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203577991 Un_KI270745v1:22433-22455 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578044 Un_KI270745v1:22675-22697 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578058 Un_KI270745v1:22724-22746 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578084 Un_KI270745v1:22822-22844 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578098 Un_KI270745v1:22871-22893 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578121 Un_KI270745v1:22967-22989 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578144 Un_KI270745v1:23064-23086 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578169 Un_KI270745v1:23161-23183 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578193 Un_KI270745v1:23258-23280 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578217 Un_KI270745v1:23355-23377 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1187236145 X:17469396-17469418 CTACCCTCTCTTAGAGAAGATGG - Intronic
1187482659 X:19672322-19672344 CTCCCCACTCTTTAAGTGGGAGG + Intronic
1189134478 X:38534317-38534339 CTCCCCTCTCAAAGAGGAGGTGG + Intronic
1189895069 X:45646888-45646910 CTACCCTCTCTTACAGAGAGGGG - Intergenic
1192822519 X:74659438-74659460 CTCTCCTCTCTTCAAGTGGAAGG + Intergenic
1192836445 X:74804652-74804674 CTCTCCTCTCTTCAAGTGGACGG + Intronic
1194823365 X:98531951-98531973 CTCTCCTCTCTTCAAGTGGAAGG - Intergenic
1198664075 X:139002620-139002642 CTCTCCTCTCTTCAAGTGGAAGG - Intronic
1200119246 X:153782699-153782721 CTCCCCTAGCTGAGGGTGGGTGG + Intronic
1202366220 Y:24167899-24167921 CTCCCCTCTCCCAGATTGGGCGG + Intergenic
1202366231 Y:24167925-24167947 CTCCCCTCTCTCTTAGTGGGCGG + Intergenic
1202380852 Y:24275965-24275987 CTGACCTCTCTCAGTGTGGGAGG - Intergenic
1202380863 Y:24276013-24276035 CTGACCTCTCTCAGTGTGGGAGG - Intergenic
1202489921 Y:25394112-25394134 CTGACCTCTCTCAGTGTGGGAGG + Intergenic
1202489932 Y:25394160-25394182 CTGACCTCTCTCAGTGTGGGAGG + Intergenic
1202504550 Y:25502198-25502220 CTCCCCTCTCTCTTAGTGGGCGG - Intergenic
1202504561 Y:25502224-25502246 CTCCCCTCTCCCAGATTGGGCGG - Intergenic