ID: 1124284437

View in Genome Browser
Species Human (GRCh38)
Location 15:28388270-28388292
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 5, 1: 5, 2: 9, 3: 9, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124284430_1124284437 -1 Left 1124284430 15:28388248-28388270 CCCCATTATTTTGGCTCCAGAGC 0: 14
1: 10
2: 6
3: 23
4: 190
Right 1124284437 15:28388270-28388292 CGGCTTTATGGACCACCTGGAGG 0: 5
1: 5
2: 9
3: 9
4: 68
1124284432_1124284437 -3 Left 1124284432 15:28388250-28388272 CCATTATTTTGGCTCCAGAGCGG 0: 8
1: 9
2: 9
3: 6
4: 73
Right 1124284437 15:28388270-28388292 CGGCTTTATGGACCACCTGGAGG 0: 5
1: 5
2: 9
3: 9
4: 68
1124284428_1124284437 28 Left 1124284428 15:28388219-28388241 CCTGAGGGCAGGTCGCTGGCGAG 0: 3
1: 14
2: 0
3: 13
4: 105
Right 1124284437 15:28388270-28388292 CGGCTTTATGGACCACCTGGAGG 0: 5
1: 5
2: 9
3: 9
4: 68
1124284431_1124284437 -2 Left 1124284431 15:28388249-28388271 CCCATTATTTTGGCTCCAGAGCG 0: 9
1: 13
2: 5
3: 6
4: 91
Right 1124284437 15:28388270-28388292 CGGCTTTATGGACCACCTGGAGG 0: 5
1: 5
2: 9
3: 9
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903920146 1:26794181-26794203 AGGCTTTGTGGACCAACTCGTGG + Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
906002122 1:42435471-42435493 CGGGCTTCTGGACAACCTGGAGG + Intronic
907403685 1:54240946-54240968 CATCTTTAGGGACCCCCTGGTGG - Exonic
912960656 1:114192530-114192552 CAGCTGCATGGTCCACCTGGAGG + Intergenic
918170254 1:181989542-181989564 CAGCTTTATGGACCTCCTTGAGG - Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
1065917428 10:30365227-30365249 TGGCTTTATGGACCTCCTGAAGG - Intronic
1069621815 10:69841928-69841950 GGGCTTTATGGACCACGTTAAGG + Intronic
1072988319 10:100164417-100164439 CTGCTGTATGGACTAGCTGGAGG - Intronic
1073048320 10:100653056-100653078 AGGCTTTGTGGACCAGCTAGTGG + Intergenic
1073321869 10:102620505-102620527 CTGCTTTATGGAGGATCTGGGGG + Intronic
1080192566 11:29569662-29569684 GAGCTTTATGGACTACATGGAGG - Intergenic
1081789711 11:45774314-45774336 CGGCCTGATGGGGCACCTGGAGG - Intergenic
1083433252 11:62625909-62625931 CGGCTTTCTGGAGATCCTGGAGG + Exonic
1084961799 11:72720815-72720837 CGGTTTGATGGACTTCCTGGAGG - Intronic
1089734409 11:120539792-120539814 TGGCTTAATGGAGCTCCTGGAGG + Intronic
1108540097 13:51434019-51434041 GGTCTTTCTGTACCACCTGGAGG + Intronic
1117069303 14:52042291-52042313 CGGGTGTATGGCCCACGTGGAGG + Exonic
1118320281 14:64748759-64748781 GGGCTTTGTGGGCCACCTGAAGG + Exonic
1121526586 14:94623604-94623626 CAGCCTTATGGACCACCTGTGGG - Exonic
1122968029 14:105140576-105140598 CGTCTTTTTGGCCAACCTGGTGG + Intergenic
1123473634 15:20571948-20571970 CGGCTTTATGGACCACCTGGAGG + Intergenic
1123644375 15:22428405-22428427 CGGCTTTATGGACCACCTGGAGG - Intergenic
1123665694 15:22608307-22608329 CAGCTTTATGGACCACCTGGAGG - Intergenic
1123733932 15:23166959-23166981 CGGCTTTATGGACCACCTGGAGG + Intergenic
1123752066 15:23364345-23364367 CAGCTTTATGGACCACCTGGAGG + Exonic
1124284437 15:28388270-28388292 CGGCTTTATGGACCACCTGGAGG + Exonic
1124298260 15:28523344-28523366 CGGCTTTATGGACCACCTGGAGG - Exonic
1124319516 15:28702721-28702743 CAGCTTTATGGACCACCTGGAGG - Exonic
1124482996 15:30092710-30092732 CAGCTTTATGGACCACCTGGAGG + Exonic
1124489446 15:30144781-30144803 CAGCTTTATGGACCACCTGAAGG + Exonic
1124520581 15:30404508-30404530 CAGCTTTATGGACCACCTGAAGG - Exonic
1124538075 15:30561711-30561733 CAGCTTTATGGACCACCTGAAGG + Exonic
1124544536 15:30613772-30613794 CAGCTTTATGGACCACCTGGAGG + Exonic
1124564499 15:30801207-30801229 CAGCTTTATGGACCAACTGGAGG + Intergenic
1124754081 15:32393546-32393568 CAGCTTTATGGACCACCTGAAGG - Exonic
1124760576 15:32445874-32445896 CAGCTTTATGGACCACCTGAAGG - Exonic
1124778058 15:32603188-32603210 CAGCTTTATGGACCACCTGAAGG + Exonic
1124959177 15:34382227-34382249 CGGCCTTATGGACCTCCTGGAGG - Exonic
1124975803 15:34528448-34528470 CGGCCTTATGGACCTCCTGGAGG - Exonic
1127947806 15:63772688-63772710 AGGCTTTAGGGACCAGCTGTGGG - Intronic
1129038585 15:72665598-72665620 CAGCTTTATGGACCTCCCGAAGG + Exonic
1129211305 15:74071632-74071654 CAGCTTTATGGACCTCCCGAAGG - Exonic
1129253773 15:74322606-74322628 AGGCTGGCTGGACCACCTGGAGG + Intronic
1129399098 15:75269455-75269477 CAGCTTTATGGACCTCCCGAAGG + Exonic
1129402705 15:75293731-75293753 CAGCTTTATGGACCTCCCGAAGG + Exonic
1129476237 15:75786153-75786175 CGGCTTTATGGACCTCCCGAAGG + Intergenic
1131188568 15:90294940-90294962 CGACTTTATGGACCTCCTGAAGG + Intronic
1131527802 15:93166531-93166553 GGGCTTCATGGGCCAGCTGGTGG - Intergenic
1132184577 15:99792198-99792220 TGGCCTTATGGACCTCCTGGAGG + Intergenic
1132432402 15:101772458-101772480 TGGCCTTATGGACCTCCTGGAGG - Intergenic
1134341036 16:13346335-13346357 CAGCTTTATAGAGCACCTGATGG + Intergenic
1135762601 16:25149080-25149102 TTGGTTAATGGACCACCTGGTGG + Intronic
1140878460 16:79175415-79175437 CAGCTTTGTGGCCGACCTGGTGG - Intronic
1141031483 16:80592625-80592647 CTGCTTTATGGAATCCCTGGGGG + Intergenic
1141186122 16:81788845-81788867 CAGGTTTCTGGGCCACCTGGGGG - Intronic
1142006230 16:87690749-87690771 GTGCTTTCTGGACAACCTGGGGG - Intronic
1147458770 17:40555167-40555189 CGGCTTTCTGGTCCCCCTGCTGG - Exonic
1153412908 18:4813883-4813905 CCGCTTGCTAGACCACCTGGTGG - Intergenic
1157753791 18:50200291-50200313 AGGCTTTAATGACCACCTGTTGG - Intergenic
1163032914 19:14556075-14556097 CGGCTTTGTGGGCCACGGGGAGG - Intronic
1164892257 19:31834436-31834458 TGGCTCTATGGGGCACCTGGAGG - Intergenic
1165662754 19:37596409-37596431 AGGCTTTGTGGGCCAGCTGGAGG - Intronic
927665072 2:25026276-25026298 TGGCTTTCTGGGCCACCTTGGGG - Intergenic
929917258 2:46146521-46146543 AGGCTTCTTGGAGCACCTGGTGG + Intronic
937955349 2:127418934-127418956 TGGCCTTTTGGAGCACCTGGTGG + Intronic
940176016 2:150878402-150878424 GGGATTTATGGACAACTTGGTGG + Intergenic
948644150 2:239393230-239393252 CCGCGCCATGGACCACCTGGAGG + Intronic
1170880113 20:20289597-20289619 GGGCTTCATGGACACCCTGGGGG - Intronic
1175692713 20:61077017-61077039 TGGATTTAGGGTCCACCTGGAGG + Intergenic
1180953714 22:19731939-19731961 CTGATTTATGGTCCTCCTGGGGG - Intergenic
1181830288 22:25555116-25555138 TGGCTGTATGGTCCACCTGGAGG + Intergenic
1184160054 22:42692581-42692603 TGGCTTTCCGCACCACCTGGGGG + Exonic
952862203 3:37822375-37822397 CAGCTCTATGGCCCACTTGGAGG - Exonic
962023795 3:131526919-131526941 CGGCTTTTTCGCCCGCCTGGTGG + Intergenic
977727715 4:100316675-100316697 CGGCTTCCTGTACCACTTGGGGG - Intergenic
979462095 4:120995503-120995525 CAGCTTTATGGATTATCTGGAGG + Intergenic
980192127 4:129538371-129538393 CAGCATTAAGGCCCACCTGGGGG + Intergenic
984997109 4:185445072-185445094 CTGCTTTTTGGTCCACTTGGTGG - Exonic
989068756 5:37489455-37489477 CAGCTATGTGTACCACCTGGGGG - Intronic
998967840 5:147559916-147559938 CGTGCTTATGAACCACCTGGGGG + Intergenic
999760819 5:154699715-154699737 GGGCTCCATGGAACACCTGGAGG + Intergenic
1007917813 6:45577281-45577303 CGGCTTTATCCACTTCCTGGTGG + Intronic
1029496406 7:100897285-100897307 CTGCTTTTTGCGCCACCTGGCGG - Intergenic
1032528859 7:132603545-132603567 CAGCTTTTTTGACCACCTGCTGG + Intronic
1044025573 8:87167593-87167615 ATGCTTTCTGAACCACCTGGTGG + Intronic
1044683488 8:94805035-94805057 ATGCGTTATGAACCACCTGGAGG + Intergenic
1048519263 8:135138651-135138673 GGGCTTTCTGGCCCACCTTGTGG + Intergenic
1049513223 8:143040090-143040112 CTGCTTTCTGGGCCCCCTGGAGG + Intronic
1049514970 8:143049490-143049512 CGGCTTTATGCAGCACCTGCAGG + Intronic
1053520101 9:38768955-38768977 CTGTTTCATGGAGCACCTGGGGG - Intergenic
1057772336 9:97979967-97979989 CTGCTTTCTGAACCAGCTGGAGG - Intergenic
1061045614 9:128163480-128163502 CTCCTGTCTGGACCACCTGGAGG + Exonic
1062533450 9:137011539-137011561 GGGCGTGATGGACCACCTGCGGG + Exonic
1187497116 X:19804735-19804757 TGGCTGTGTGGATCACCTGGGGG - Intronic