ID: 1124287421

View in Genome Browser
Species Human (GRCh38)
Location 15:28414652-28414674
Sequence CTGCTGTCCCAGTGGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124287417_1124287421 -10 Left 1124287417 15:28414639-28414661 CCCTTCAGTTCTACTGCTGTCCC No data
Right 1124287421 15:28414652-28414674 CTGCTGTCCCAGTGGAAAAAGGG No data
1124287416_1124287421 17 Left 1124287416 15:28414612-28414634 CCTGCTGAGGTAGCTGTTGTCTG No data
Right 1124287421 15:28414652-28414674 CTGCTGTCCCAGTGGAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124287421 Original CRISPR CTGCTGTCCCAGTGGAAAAA GGG Intergenic
No off target data available for this crispr