ID: 1124287945

View in Genome Browser
Species Human (GRCh38)
Location 15:28420355-28420377
Sequence CTGCTGTCCCAGTGGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124287941_1124287945 -10 Left 1124287941 15:28420342-28420364 CCCTTCAGTTCTACTGCTGTCCC No data
Right 1124287945 15:28420355-28420377 CTGCTGTCCCAGTGGAAAAAGGG No data
1124287940_1124287945 17 Left 1124287940 15:28420315-28420337 CCTGCTGAGGTAGCTGTTGTCTG No data
Right 1124287945 15:28420355-28420377 CTGCTGTCCCAGTGGAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124287945 Original CRISPR CTGCTGTCCCAGTGGAAAAA GGG Intergenic
No off target data available for this crispr