ID: 1124295281

View in Genome Browser
Species Human (GRCh38)
Location 15:28496972-28496994
Sequence CTGCTGTCCCAGTGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124295281_1124295285 -10 Left 1124295281 15:28496972-28496994 CCCTTTTTCCACTGGGACAGCAG No data
Right 1124295285 15:28496985-28497007 GGGACAGCAGTAGAACTGAAGGG No data
1124295281_1124295286 17 Left 1124295281 15:28496972-28496994 CCCTTTTTCCACTGGGACAGCAG No data
Right 1124295286 15:28497012-28497034 CAGACAACAGCTACCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124295281 Original CRISPR CTGCTGTCCCAGTGGAAAAA GGG (reversed) Intergenic
No off target data available for this crispr