ID: 1124299622

View in Genome Browser
Species Human (GRCh38)
Location 15:28531075-28531097
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 6, 1: 0, 2: 5, 3: 20, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124299622 Original CRISPR GTGTTCCAGCAGGAGCCAAG AGG (reversed) Exonic
900526962 1:3134135-3134157 AGGTCCCAGCAGGAGCCCAGAGG - Intronic
900883997 1:5402642-5402664 GTGATCCAGCAGCAGACCAGAGG - Intergenic
901007175 1:6177815-6177837 GTGTTCCAGAAGCAGCAAGGAGG + Intronic
901225640 1:7611549-7611571 GTGAGAGAGCAGGAGCCAAGTGG + Intronic
902516197 1:16990921-16990943 GTGAGACAGCAGGAGCTAAGAGG - Intronic
902561968 1:17283174-17283196 GTGTTCCATCTGGAGCCTTGGGG - Exonic
904027501 1:27513843-27513865 GTGTTCCGCCAGGAACCAAATGG + Intergenic
904594992 1:31638356-31638378 GTGTTGTAGCAGGAGGCAGGGGG - Intronic
907287428 1:53390793-53390815 GTATTCCAGCAGCAGCCTGGTGG - Intergenic
908148316 1:61271599-61271621 GTGTTCCTGCAGCAGCCACTTGG - Intronic
912823404 1:112885142-112885164 CTGTTTCAGTAGGAGCCCAGAGG + Intergenic
915505725 1:156355089-156355111 GTGTTGGAGCAGGACCCAACAGG - Intronic
917296285 1:173522785-173522807 GTGTTCCAGGAGCAGCACAGAGG - Intronic
917409609 1:174745074-174745096 GTGGTCCAGCTGATGCCAAGTGG - Intronic
919941556 1:202290484-202290506 GTTTTAAACCAGGAGCCAAGAGG + Intronic
920366850 1:205452455-205452477 CTGTTCCAACAGGAGCCAGTGGG + Intronic
920493888 1:206440438-206440460 GTGTACAAGCAGCAGCCCAGAGG + Intronic
920635243 1:207695926-207695948 GTGTTGGAGGAGGAGCCTAGTGG - Intronic
920937998 1:210454119-210454141 GTGTTGCAGGAGGAACCCAGCGG - Intronic
921697108 1:218224147-218224169 GTGGACCAGGAAGAGCCAAGGGG + Intergenic
922743594 1:228030677-228030699 GTGTTTGAGAAGCAGCCAAGAGG - Intronic
923754557 1:236779208-236779230 GTGTTGCAGGAGGAACCTAGTGG - Intergenic
924122391 1:240814415-240814437 GTCTTCCAGCAGGAGTGAAAAGG + Intronic
924444720 1:244118533-244118555 GTGGCCCAGCAGGACCCAGGGGG + Intergenic
924771723 1:247085696-247085718 GTGGTCCAGGAGCAGCCAAGGGG - Intergenic
924775878 1:247114287-247114309 GTGGTCCAGGAGCAGCCAAGGGG + Intergenic
924783764 1:247175502-247175524 GTGTTCCAGCAGCAGACAGGAGG + Intergenic
1064035831 10:11912734-11912756 TTGTTGCAGCAGAAGCCCAGAGG - Intergenic
1065047760 10:21759222-21759244 GCGTTGCAGCAGTACCCAAGGGG - Exonic
1065206209 10:23360120-23360142 GGGTTGTAGCAGGAGCAAAGAGG - Intergenic
1067349645 10:45464351-45464373 GTGTTCAGGTAAGAGCCAAGGGG + Intronic
1068130227 10:52887436-52887458 GCTTGCCAGCAGGAGGCAAGGGG - Intergenic
1068314189 10:55320256-55320278 GTGTGCCAGCAATGGCCAAGTGG - Intronic
1069785293 10:70983965-70983987 GGGTTCCAGCAGGAAACATGTGG + Intergenic
1070392066 10:75979823-75979845 GTGTTCCTGCAGGACACAACAGG + Intronic
1070473900 10:76813286-76813308 GCATTCCAGCAGGAACAAAGAGG - Intergenic
1073785488 10:106884654-106884676 GTGTTCACGCAGCAGACAAGTGG - Intronic
1075264428 10:120988685-120988707 GGGTGACAGCAGGAGCCCAGGGG - Intergenic
1076246257 10:128949902-128949924 CTGTTCCGACAGGTGCCAAGTGG - Intergenic
1077228182 11:1447372-1447394 GAGTTGCAGCAGAGGCCAAGAGG - Intronic
1080579571 11:33631299-33631321 GTGTTCAGGCTGGAGCCAAGGGG - Intronic
1082200953 11:49366505-49366527 GTGTTACAGCAGGAGCCTTCTGG - Intergenic
1084224835 11:67709686-67709708 GTGTGCCAGGAGCAGCCAGGTGG + Intergenic
1084262654 11:67989529-67989551 GTGTGCCAGGAGCAGCCAGGTGG + Intergenic
1084483706 11:69436201-69436223 GTGTCCAAGCATGACCCAAGGGG + Intergenic
1085095887 11:73760565-73760587 GTGTTCCTGGGGGAGCAAAGCGG - Exonic
1086276049 11:85130402-85130424 GAGGTCTAGGAGGAGCCAAGGGG + Intronic
1086654719 11:89339700-89339722 GTGTTACAGCAGGAGCCTTCTGG + Intronic
1090356867 11:126146420-126146442 GAGTTCCAGCAGGAAGCAGGGGG + Intergenic
1091798090 12:3308724-3308746 GTGTTCTTGCAGCAGCCAACAGG + Intergenic
1091967128 12:4754290-4754312 GTGTTCCTCCAGGTCCCAAGTGG + Intronic
1094096606 12:26712300-26712322 TGGTTGCAGCAGGAGCCAAAGGG - Intronic
1096419496 12:51444912-51444934 GTATACCAGCATGAGCCCAGTGG + Intronic
1096753081 12:53775667-53775689 GTTGTTCAGCAGGAGCCATGAGG + Intergenic
1097688050 12:62709467-62709489 CTGTGCCAGCAGAAGCCCAGAGG - Intronic
1098235063 12:68410395-68410417 GTGATCCAGCAGGAGACACTTGG + Intergenic
1098974772 12:76890988-76891010 GTGATTCTGCAGGAGCAAAGGGG - Intergenic
1101043841 12:100784336-100784358 GTGTTCCAAAAGGGGACAAGGGG - Intronic
1102687180 12:114734273-114734295 GTGCTCCAGGAGGAGGGAAGAGG - Intergenic
1102783233 12:115583674-115583696 GTGTTTCAGCAGAAGGAAAGTGG - Intergenic
1103792401 12:123480975-123480997 GTGACCCAGCTGGAGCCAATGGG + Intronic
1105593166 13:21812554-21812576 GTGTTCAAGCCGGACCCCAGAGG - Intergenic
1106464979 13:30005386-30005408 ATGTTCCAGCAGCAGCCAGATGG + Intergenic
1107541614 13:41394304-41394326 GTGTTGTAGGAGGAGCCCAGTGG - Intergenic
1108084967 13:46777930-46777952 ATGTTCTTGCTGGAGCCAAGAGG - Intronic
1111376912 13:87392262-87392284 GGGTTCCAGTAAGAGCCAAGGGG - Intergenic
1113632576 13:111898121-111898143 GAGCTCCAGCAGGAACCCAGCGG + Intergenic
1118778207 14:68987718-68987740 GCATTCCAGGAGCAGCCAAGAGG + Intergenic
1119375926 14:74192795-74192817 ATGTTCCAGCAGCAGACAGGAGG + Intronic
1119613459 14:76082926-76082948 GGGTGCCATCAGGTGCCAAGTGG - Intronic
1119617625 14:76109264-76109286 GTGTTGCAGCTGGCGCCAATGGG - Intergenic
1120392428 14:83925217-83925239 GTGTTAGAGGAGGAGCCTAGTGG + Intergenic
1121304573 14:92898079-92898101 GTGTGCCTGCAGGGTCCAAGAGG - Intergenic
1121892996 14:97615167-97615189 GAGTTCCAGAAGGAGAAAAGAGG - Intergenic
1121947736 14:98138870-98138892 GCGTTCCAACGGGAGCCAAGAGG - Intergenic
1122100182 14:99402281-99402303 GTGAACCAGCAGGAGCAATGTGG + Intronic
1123113257 14:105882655-105882677 GGGTCCCGGCAGGAGCCAGGTGG + Intergenic
1123121827 14:105920300-105920322 GGGTCCCAGCAGGAGCCAGGTGG + Intronic
1123402589 15:20003091-20003113 GGGTCCCAGCCGGAGCCAGGTGG + Intergenic
1123472268 15:20564251-20564273 GTGTTCCAGCAGGAGCCAAGAGG + Intergenic
1123511927 15:21009745-21009767 GGGTCCCAGCCGGAGCCAGGTGG + Intergenic
1123645735 15:22436102-22436124 GTGTTCCAGCAGGAGCCAAGAGG - Intergenic
1123667044 15:22615985-22616007 GAGTTCCAGCAGGAGCGAACAGG - Intergenic
1123732573 15:23159242-23159264 GTGTTCCAGCAGGAGCCAAGAGG + Intergenic
1123750706 15:23356622-23356644 GTGTTCCAGCAGGAGCCAAGAGG + Exonic
1124283077 15:28380538-28380560 GTGTTCCAGCAGGAGCCAAGAGG + Exonic
1124299622 15:28531075-28531097 GTGTTCCAGCAGGAGCCAAGAGG - Exonic
1124320885 15:28710553-28710575 GAGTTCCAGCAGGAGCGAACAGG - Exonic
1124481609 15:30084802-30084824 GAGTTCCAGCAGGAGCGAACAGG + Exonic
1124488066 15:30136897-30136919 GAGTTCCAGCAGGAGCGAACAGG + Exonic
1124521983 15:30412395-30412417 GAGTTCCAGCAGGAGTGAACAGG - Exonic
1124543156 15:30605874-30605896 GAGTTCCAGCAGGAGCGAACAGG + Exonic
1124563110 15:30793322-30793344 GAGTTCCAGAAGGAGCCAAGAGG + Intergenic
1124755461 15:32401422-32401444 GAGTTCCAGCAGGAGCGAACAGG - Exonic
1124761971 15:32453769-32453791 GAGTTCCAGCAGGAGTGAACAGG - Exonic
1124776658 15:32595299-32595321 GAGTTCCAGCAGGAGTGAACAGG + Exonic
1124960178 15:34387899-34387921 GTGTTCCAGCAGCAGCGAAGAGG - Exonic
1124976807 15:34534120-34534142 GTGTTCCAGCAGCAGCGAAGAGG - Exonic
1125547029 15:40513358-40513380 CTGTTCCAGGAGGACCCAGGAGG - Intergenic
1128214782 15:65926845-65926867 GAATCTCAGCAGGAGCCAAGTGG - Intronic
1129136472 15:73556882-73556904 GTTTTGCAGCAGGGGGCAAGGGG - Intronic
1129724923 15:77896841-77896863 GTGTTCCTGGAGGTGACAAGAGG - Intergenic
1130260065 15:82347576-82347598 GCATTCCAGCAGGAGCTAACAGG - Exonic
1130268664 15:82431861-82431883 GCATTCCAGCAGGAGCTAACAGG + Exonic
1130281167 15:82521435-82521457 GCATTCCAGCAGGAGCTAACAGG + Intergenic
1130472538 15:84237617-84237639 GCATTCCAGCAGGAGCTAACAGG + Exonic
1130480030 15:84352188-84352210 GCATTCCAGCAGGAGCTAACAGG + Intergenic
1130491740 15:84435941-84435963 GCATTCCAGCAGGAGCTAACAGG - Intergenic
1130503355 15:84514981-84515003 GCATTCCAGCAGGAGCTAACAGG - Intergenic
1130594835 15:85242251-85242273 GCATTCCAGCAGGAGCTAACAGG + Intergenic
1132433722 15:101780063-101780085 GTGTTCCAGCAGGAGCAGAGAGG - Intergenic
1132574104 16:656847-656869 GTGTTCCACCAGGACCTCAGCGG - Exonic
1134090518 16:11389171-11389193 GAGTTTCAGCAAGAGCCACGGGG - Intronic
1136459822 16:30402866-30402888 GTGTTCTAGCAGGAGAAGAGTGG - Intergenic
1136655549 16:31707031-31707053 ACCTTCCAGCAGGAGCCAGGTGG - Intergenic
1136672449 16:31870904-31870926 GTGTTCCAGAAGCAGACAGGAGG - Intergenic
1138066036 16:53942289-53942311 TTATTCCAGCATGAGCAAAGAGG + Intronic
1138102535 16:54265192-54265214 ATGTTCCAGCAGCAACCAAAAGG - Intronic
1138975391 16:62200733-62200755 GTGTTCCAACAGTATACAAGGGG + Intergenic
1139401667 16:66686607-66686629 GTGGTCCAGGAGGAGCCATTAGG + Intronic
1141623630 16:85250048-85250070 GAGCTGCAGCAGGAGCCAGGCGG - Intergenic
1142904480 17:3033051-3033073 GAGTCACAGCTGGAGCCAAGAGG + Intronic
1143599463 17:7934702-7934724 GTGTTCCTGAAGGAGTAAAGGGG - Intronic
1145864262 17:28230094-28230116 GTGTTCCAGCCAGTGGCAAGTGG + Intergenic
1145917724 17:28585799-28585821 GTGTTCCTGCAGGAACCTTGAGG + Intronic
1146506968 17:33414072-33414094 TTGTTCCCGCAGCAGCCCAGTGG + Intronic
1147047792 17:37767638-37767660 GTGTTCCAGAAAGAGCCAGGAGG - Intergenic
1148783978 17:50136229-50136251 GGGGGCCAGCAGGAGCCAAAGGG + Intronic
1149347909 17:55756861-55756883 ATTTTCCAGGAGGAGCCAGGAGG + Intronic
1151820691 17:76495177-76495199 GTGGTCCAGCACAAGCCCAGCGG + Intronic
1152282363 17:79392508-79392530 CTGTTCCTGCTGGAGCCACGGGG + Intronic
1154383829 18:13875723-13875745 GTGGTCCAGCAAGACCCCAGGGG + Intergenic
1156481989 18:37442070-37442092 TTGTGCCAGCAGGAGCCAGTGGG - Intronic
1157585630 18:48799431-48799453 GGGATCCAGTAGGACCCAAGAGG - Intronic
1157780109 18:50430806-50430828 GGGTTCCAGCAGCAGCTGAGAGG + Intergenic
1159778079 18:72626738-72626760 ATGATCCAGAAGGAGCCAAAAGG + Intronic
1160346758 18:78138385-78138407 GTGCTCCAGCAGGAGGGAAAAGG - Intergenic
1161730857 19:5959737-5959759 GTGTGCCACCAGGATCCTAGAGG + Intronic
1163578867 19:18126301-18126323 CTGGTCCAGCAGTAGCCAGGGGG + Intronic
1165876737 19:39013130-39013152 GTGTTGTAGCAGGAGAGAAGTGG + Intronic
1166547475 19:43641861-43641883 CTTTTCCCGCAGGAGCCAATAGG + Intergenic
1167288702 19:48613125-48613147 GTGGCCAAGCAGGAGCCCAGCGG - Exonic
925259457 2:2517204-2517226 CTGTGCCAGCTGGAGCCAGGAGG + Intergenic
928096290 2:28407098-28407120 GTTGTCCAGAAGCAGCCAAGGGG + Intronic
928939500 2:36713325-36713347 GTGTTCCAGAAACAGCCAAGAGG + Intronic
930440830 2:51403422-51403444 GTGTTTCAGGAGGAACCCAGTGG - Intergenic
930535991 2:52647493-52647515 GTGTCCCAGGAGGTGCCCAGTGG - Intergenic
932112572 2:69013907-69013929 GTGTCCCAGGAGCAGGCAAGGGG + Intronic
934774399 2:96927943-96927965 CTGTGCCAGGAGGAGGCAAGTGG + Intronic
935268084 2:101411535-101411557 GTGATCCAGCTGGGGGCAAGAGG + Intronic
936290868 2:111223041-111223063 GGGTTCAAGCAGGATCCATGGGG + Intergenic
937089713 2:119198028-119198050 GTGTTCCAGCAGCTCACAAGAGG - Intergenic
938198661 2:129355107-129355129 GTGTTGAAGCAGGACTCAAGAGG - Intergenic
939749629 2:146027184-146027206 GGGTTCCAGCAGGATCCATATGG - Intergenic
944662043 2:201929294-201929316 TAGTTACAGAAGGAGCCAAGTGG - Intergenic
946201127 2:218071375-218071397 GTGCTCCAGGAAGATCCAAGAGG - Intronic
946409748 2:219510096-219510118 GGGTTTCATCAGGGGCCAAGAGG - Intergenic
947964797 2:234270347-234270369 GTGTTAAAGGAGGAGCCTAGTGG + Intergenic
948550640 2:238770476-238770498 GTGCTCCAGGAGGAGCCCAGTGG - Intergenic
1168867106 20:1096247-1096269 GTGTTACAGCAGGAGCTCAAGGG - Intergenic
1170180373 20:13523389-13523411 ATGTGACAGCAGGAGCCAATGGG - Intronic
1171009113 20:21498299-21498321 GTGTTGCAGCAGTAACCCAGAGG - Intergenic
1172424591 20:34846628-34846650 CTGTTCAAACAGCAGCCAAGGGG + Intronic
1172776610 20:37411111-37411133 GTGTTCTAGGAAGAACCAAGGGG - Intergenic
1175618689 20:60424801-60424823 CTGTCCCGGCAGGAGCCAAGAGG - Intergenic
1179141556 21:38730294-38730316 ATGTTCCGGCAGGTTCCAAGAGG - Intergenic
1179966118 21:44806988-44807010 GTGTTCCAGCAGCAGACGGGAGG - Exonic
1180045400 21:45302833-45302855 GGGCTCCAGCAGCAGCCAGGCGG - Intergenic
1181782376 22:25202435-25202457 GATGTCCAGCAGGAGCCAGGTGG - Intronic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1181881690 22:25985589-25985611 GTGTTCCAGCAAGAGCTCAAAGG - Intronic
1184188670 22:42880752-42880774 GTGTCCCAGCCAGAGCCTAGGGG - Intronic
1184931675 22:47685991-47686013 GTGTTGCAGGAGGAACCTAGTGG - Intergenic
950424749 3:12919114-12919136 GTGTCCAAGCAGCAGCCAGGAGG - Intronic
952319441 3:32262262-32262284 GTCTGCCAGCAGGAACAAAGAGG + Intronic
954139701 3:48598600-48598622 GTGGACCAGAAGGGGCCAAGGGG - Intergenic
957078087 3:75617471-75617493 GTGTGCCAGGAGCAGCCAGGTGG + Intergenic
957648720 3:82970596-82970618 TTTTTCTAGCAGAAGCCAAGAGG + Intergenic
959578117 3:107957023-107957045 TTGTACCAGCCGGAGCCCAGAGG + Intergenic
960054213 3:113265082-113265104 AGGGTGCAGCAGGAGCCAAGAGG + Intronic
964371303 3:156003540-156003562 GTCTCCCAGCAGGAGGCATGGGG + Intergenic
968231538 3:197007586-197007608 GTGCTCCTGCACGAGCCCAGCGG - Intronic
969732699 4:8965976-8965998 GTGTGCCAGGAGCAGCCAGGTGG - Intergenic
976717433 4:88137625-88137647 ATTGTCCAGGAGGAGCCAAGGGG - Intronic
979604806 4:122626632-122626654 GAGTTCCAGCAGCAGCCACATGG + Intergenic
980529201 4:134029210-134029232 ATGTTCCAGCAGGATCCGGGAGG + Intergenic
981871226 4:149487973-149487995 GTGTTCCAGCAGGGGGTTAGGGG + Intergenic
983498760 4:168475913-168475935 GTGAGCAAGCAGGAGCAAAGGGG - Intronic
983927622 4:173418698-173418720 GTGTTGCAGGAGGGGCCAGGTGG + Intergenic
985191079 4:187373513-187373535 GTGTTGCAGGAGGGGCCCAGTGG - Intergenic
985933690 5:3078751-3078773 GTGATCTACCATGAGCCAAGAGG + Intergenic
986018518 5:3779378-3779400 GTGAACCACCAGGAGCAAAGAGG - Intergenic
989549299 5:42714393-42714415 GTTCTCCAGCTGAAGCCAAGAGG + Intronic
990002089 5:50906191-50906213 ATGTTCCAGGAAGAGCCAGGAGG + Intergenic
991622732 5:68562317-68562339 GTTTTCCAGCATTAGACAAGAGG + Intergenic
992460445 5:76954625-76954647 GTGGACCAGCAGGAGCGAGGCGG - Intronic
995385778 5:111586945-111586967 GTGTTGAAGCAGGAGCCTTGTGG - Intergenic
996829324 5:127721954-127721976 GTGTTGGAGGAGGAGCCTAGTGG - Intergenic
997273872 5:132565836-132565858 GAGTTCCAGCAGGATGAAAGAGG - Intronic
997943977 5:138182965-138182987 GTGTACCAGCAGTAGCCAGCTGG + Exonic
998058967 5:139104246-139104268 GTGGTCTAGGAGGAGCCAGGAGG - Intronic
999720317 5:154394611-154394633 GTGTTCCAGGAAGGGCCCAGAGG + Intronic
999730944 5:154476417-154476439 CTCTTTCAGCAGGAACCAAGCGG + Intronic
999948142 5:156619644-156619666 CTTTTCCAGCAGAGGCCAAGGGG + Intronic
1000866747 5:166523638-166523660 GTGTTGCAGTGGGAGGCAAGTGG - Intergenic
1002551886 5:180000493-180000515 GTGTTCCAGAAGGAGAGAAGGGG - Intronic
1002820166 6:717384-717406 GTGATCCAGGAAGAGCAAAGTGG + Intergenic
1003571195 6:7257805-7257827 GGCCTCCACCAGGAGCCAAGGGG + Intergenic
1004342892 6:14823176-14823198 GTGTTCTAGGAGCAGCAAAGAGG + Intergenic
1009771165 6:68144685-68144707 GAGTTCCCTCAGGAGCCAGGTGG + Intergenic
1011250188 6:85363167-85363189 GTGTTCCAGCAGTAGGACAGGGG - Intergenic
1013612508 6:111808236-111808258 GGGTACCAGCAGGAGACAGGTGG + Intronic
1015750703 6:136555518-136555540 GTGTTTCAGTATGAGCCAAATGG + Intergenic
1015985347 6:138879053-138879075 GTGTTTCAGCAGCAGGCAGGAGG - Intronic
1017567294 6:155701325-155701347 GGGTTCCAGAAGGAAACAAGCGG + Intergenic
1017822645 6:158060369-158060391 ACGTTCCAGAATGAGCCAAGGGG + Intronic
1018029033 6:159827491-159827513 CTGTTCCAGCTGCAGCCATGTGG + Intergenic
1018811045 6:167298473-167298495 GTGTTTCAGCTGTGGCCAAGGGG + Intronic
1019162888 6:170080828-170080850 GTGCTCCAGCCTGAGCCAACGGG - Intergenic
1019892832 7:3960366-3960388 GTGTTCTGGCAAGAGCCAGGTGG - Intronic
1020308584 7:6853474-6853496 GTGTGCCAGGAGCAGCCAGGTGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022142993 7:27509361-27509383 GTGTAGCAGCAGAAGCCATGAGG + Intergenic
1022452038 7:30524433-30524455 GTGTTCCAGCAGGAGTGAAGAGG - Intronic
1024046726 7:45590264-45590286 GTGTTCCAGGAGGAAACCAGGGG + Intronic
1024161814 7:46683671-46683693 TTGTTCCAGGAGCATCCAAGGGG - Intronic
1024374648 7:48623072-48623094 GTGCTCCAGCAGGAAGGAAGCGG - Intronic
1024917352 7:54515893-54515915 CTGTTCCTGCAGGACCCAGGAGG - Intergenic
1026377889 7:69770499-69770521 TGGCTCCAGCTGGAGCCAAGAGG - Intronic
1027946722 7:84756694-84756716 GTGTTCCTGCAGGAGGCTGGAGG - Intergenic
1028582447 7:92422028-92422050 GAGTTCCAGCTGGAGACAGGAGG - Intergenic
1028755153 7:94425815-94425837 GTTTGCCAGCAGGACCCACGGGG - Exonic
1029788252 7:102815442-102815464 GCAATCCAGCAGAAGCCAAGAGG - Intronic
1030187540 7:106778405-106778427 GAGTTCCAGCAGGGCCCAAAAGG + Intergenic
1031773054 7:125870216-125870238 GTGTTGGAGGAGGAGCCTAGTGG - Intergenic
1032191593 7:129769001-129769023 GTGTCCCAGCAGGTGCCGTGTGG + Intergenic
1033845578 7:145427910-145427932 GTGTATCAGCAGAAACCAAGTGG + Intergenic
1037762912 8:21753894-21753916 GTGTTCCAGGAAGATCCAGGAGG - Intronic
1038494207 8:27990180-27990202 CTGGTCCAGCAGGAGCCCAGGGG + Intronic
1040744237 8:50620435-50620457 GTGTTCCTACAGGTGCCAAAGGG - Intronic
1042884279 8:73530804-73530826 GAATCCCAGCAGAAGCCAAGGGG + Intronic
1042945929 8:74154423-74154445 ATGTTCCAGCATGGCCCAAGGGG + Intergenic
1044998298 8:97858056-97858078 GTGTTGCAGCAGCAGACAGGAGG - Intergenic
1046474827 8:114728778-114728800 GTGGTCCTCCAGGGGCCAAGGGG + Intergenic
1049029525 8:140024133-140024155 TTGATCCACCAGGAGGCAAGCGG + Intronic
1049072106 8:140364110-140364132 GTGTCCCCGAAGGAGGCAAGAGG + Intronic
1049318096 8:141980394-141980416 GTGCAGCAGCAGGAGCCACGTGG + Intergenic
1049688665 8:143949403-143949425 CTGTACCAGCAGGACCCAGGTGG - Intronic
1049934897 9:492089-492111 GTGTTCCAGGAACAGCCAGGAGG + Intronic
1051515200 9:17922944-17922966 GTGTTCCAGCAGGTTACACGAGG - Intergenic
1052031334 9:23632328-23632350 GTATTCCAGCAGCAGACAGGAGG + Intergenic
1056287939 9:85110246-85110268 GTGTTCCAGGAGCAGCCAGGAGG - Intergenic
1057010917 9:91600597-91600619 ATTTTCCAGCAGAAGCCGAGGGG - Intronic
1060218078 9:121750436-121750458 GTGTGCAAGCAGGAGCCGGGGGG - Intronic
1061223688 9:129267528-129267550 GTGACCCAGCAGGGGGCAAGTGG + Intergenic
1062190342 9:135244813-135244835 CTGCTCCGGCAGGAGGCAAGGGG - Intergenic
1062235737 9:135506716-135506738 GTGTTGGGGCAGGAGCCTAGCGG + Intergenic
1186474311 X:9845433-9845455 CTGTTCCAGCAGGAAGCAGGGGG - Intronic
1186663301 X:11691756-11691778 ATGTTGGAGGAGGAGCCAAGTGG - Intergenic
1189193028 X:39127581-39127603 GTGTTCCCAGAGGACCCAAGAGG - Intergenic
1190314483 X:49141387-49141409 GTTTTCCAGCAGGGATCAAGGGG + Intergenic
1194045569 X:88997599-88997621 GTCTGCCTGAAGGAGCCAAGGGG - Intergenic
1196616844 X:117775939-117775961 GAGTCCCAGCAGGAAGCAAGTGG - Intergenic
1198443940 X:136692424-136692446 TTGTTCCAGAAGTAGCCAAAGGG + Intronic
1200254132 X:154570333-154570355 GTGTTCGAGGAAGGGCCAAGAGG - Intergenic
1200263637 X:154634075-154634097 GTGTTCGAGGAAGGGCCAAGAGG + Intergenic
1202373831 Y:24215528-24215550 GCATTCCAGCAGGAGCTAACAGG - Intergenic
1202496950 Y:25454592-25454614 GCATTCCAGCAGGAGCTAACAGG + Intergenic