ID: 1124302887

View in Genome Browser
Species Human (GRCh38)
Location 15:28558943-28558965
Sequence CACCTGTGGCAGCAGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124302887_1124302900 21 Left 1124302887 15:28558943-28558965 CCAAGCTCCTGCTGCCACAGGTG No data
Right 1124302900 15:28558987-28559009 TGTGGGAGACCCATCCAGCTGGG No data
1124302887_1124302899 20 Left 1124302887 15:28558943-28558965 CCAAGCTCCTGCTGCCACAGGTG No data
Right 1124302899 15:28558986-28559008 TTGTGGGAGACCCATCCAGCTGG No data
1124302887_1124302901 28 Left 1124302887 15:28558943-28558965 CCAAGCTCCTGCTGCCACAGGTG No data
Right 1124302901 15:28558994-28559016 GACCCATCCAGCTGGGACCATGG No data
1124302887_1124302892 -4 Left 1124302887 15:28558943-28558965 CCAAGCTCCTGCTGCCACAGGTG No data
Right 1124302892 15:28558962-28558984 GGTGAGCAGCTGCAGCCCCGGGG No data
1124302887_1124302893 -3 Left 1124302887 15:28558943-28558965 CCAAGCTCCTGCTGCCACAGGTG No data
Right 1124302893 15:28558963-28558985 GTGAGCAGCTGCAGCCCCGGGGG No data
1124302887_1124302894 3 Left 1124302887 15:28558943-28558965 CCAAGCTCCTGCTGCCACAGGTG No data
Right 1124302894 15:28558969-28558991 AGCTGCAGCCCCGGGGGTTGTGG No data
1124302887_1124302890 -6 Left 1124302887 15:28558943-28558965 CCAAGCTCCTGCTGCCACAGGTG No data
Right 1124302890 15:28558960-28558982 CAGGTGAGCAGCTGCAGCCCCGG No data
1124302887_1124302891 -5 Left 1124302887 15:28558943-28558965 CCAAGCTCCTGCTGCCACAGGTG No data
Right 1124302891 15:28558961-28558983 AGGTGAGCAGCTGCAGCCCCGGG No data
1124302887_1124302895 4 Left 1124302887 15:28558943-28558965 CCAAGCTCCTGCTGCCACAGGTG No data
Right 1124302895 15:28558970-28558992 GCTGCAGCCCCGGGGGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124302887 Original CRISPR CACCTGTGGCAGCAGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr