ID: 1124304356

View in Genome Browser
Species Human (GRCh38)
Location 15:28567329-28567351
Sequence GGAAACTGCCCCGCTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124304344_1124304356 24 Left 1124304344 15:28567282-28567304 CCCCTGTCCCCTGAGCCTTCGTT No data
Right 1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG No data
1124304343_1124304356 25 Left 1124304343 15:28567281-28567303 CCCCCTGTCCCCTGAGCCTTCGT No data
Right 1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG No data
1124304350_1124304356 9 Left 1124304350 15:28567297-28567319 CCTTCGTTAGTGCCTCATTAACT No data
Right 1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG No data
1124304349_1124304356 15 Left 1124304349 15:28567291-28567313 CCTGAGCCTTCGTTAGTGCCTCA No data
Right 1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG No data
1124304347_1124304356 17 Left 1124304347 15:28567289-28567311 CCCCTGAGCCTTCGTTAGTGCCT No data
Right 1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG No data
1124304346_1124304356 22 Left 1124304346 15:28567284-28567306 CCTGTCCCCTGAGCCTTCGTTAG No data
Right 1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG No data
1124304352_1124304356 -3 Left 1124304352 15:28567309-28567331 CCTCATTAACTTCCCTGTAAGGA No data
Right 1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG No data
1124304345_1124304356 23 Left 1124304345 15:28567283-28567305 CCCTGTCCCCTGAGCCTTCGTTA No data
Right 1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG No data
1124304348_1124304356 16 Left 1124304348 15:28567290-28567312 CCCTGAGCCTTCGTTAGTGCCTC No data
Right 1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124304356 Original CRISPR GGAAACTGCCCCGCTGAGGC TGG Intergenic
No off target data available for this crispr