ID: 1124305923

View in Genome Browser
Species Human (GRCh38)
Location 15:28578803-28578825
Sequence TCCTGGAGCAGGGTTTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124305918_1124305923 -7 Left 1124305918 15:28578787-28578809 CCAAAAGACTGGACCCTCCTGGA No data
Right 1124305923 15:28578803-28578825 TCCTGGAGCAGGGTTTTCACAGG No data
1124305909_1124305923 29 Left 1124305909 15:28578751-28578773 CCAAGACAATTCTTCTTCCAGTG 0: 141
1: 382
2: 397
3: 233
4: 394
Right 1124305923 15:28578803-28578825 TCCTGGAGCAGGGTTTTCACAGG No data
1124305916_1124305923 2 Left 1124305916 15:28578778-28578800 CCAGGGAAACCAAAAGACTGGAC 0: 10
1: 116
2: 894
3: 994
4: 751
Right 1124305923 15:28578803-28578825 TCCTGGAGCAGGGTTTTCACAGG No data
1124305915_1124305923 3 Left 1124305915 15:28578777-28578799 CCCAGGGAAACCAAAAGACTGGA 0: 8
1: 132
2: 905
3: 1022
4: 794
Right 1124305923 15:28578803-28578825 TCCTGGAGCAGGGTTTTCACAGG No data
1124305908_1124305923 30 Left 1124305908 15:28578750-28578772 CCCAAGACAATTCTTCTTCCAGT 0: 130
1: 394
2: 410
3: 264
4: 747
Right 1124305923 15:28578803-28578825 TCCTGGAGCAGGGTTTTCACAGG No data
1124305913_1124305923 12 Left 1124305913 15:28578768-28578790 CCAGTGTGGCCCAGGGAAACCAA 0: 23
1: 354
2: 884
3: 838
4: 683
Right 1124305923 15:28578803-28578825 TCCTGGAGCAGGGTTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124305923 Original CRISPR TCCTGGAGCAGGGTTTTCAC AGG Intergenic
No off target data available for this crispr