ID: 1124309674

View in Genome Browser
Species Human (GRCh38)
Location 15:28611414-28611436
Sequence CTACCTACGGGGAAATGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124309674_1124309682 -3 Left 1124309674 15:28611414-28611436 CCTCCCCATTTCCCCGTAGGTAG No data
Right 1124309682 15:28611434-28611456 TAGTCATTGGTACTTGCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124309674 Original CRISPR CTACCTACGGGGAAATGGGG AGG (reversed) Intergenic
No off target data available for this crispr