ID: 1124310018

View in Genome Browser
Species Human (GRCh38)
Location 15:28614929-28614951
Sequence ATTTATAAACAAATACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124310018_1124310023 24 Left 1124310018 15:28614929-28614951 CCCTCCAGTATTTGTTTATAAAT No data
Right 1124310023 15:28614976-28614998 TGTGAAACAATAGTTCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124310018 Original CRISPR ATTTATAAACAAATACTGGA GGG (reversed) Intergenic
No off target data available for this crispr