ID: 1124310023

View in Genome Browser
Species Human (GRCh38)
Location 15:28614976-28614998
Sequence TGTGAAACAATAGTTCTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124310021_1124310023 -9 Left 1124310021 15:28614962-28614984 CCCAAAGTGTTTTCTGTGAAACA No data
Right 1124310023 15:28614976-28614998 TGTGAAACAATAGTTCTAAAAGG No data
1124310018_1124310023 24 Left 1124310018 15:28614929-28614951 CCCTCCAGTATTTGTTTATAAAT No data
Right 1124310023 15:28614976-28614998 TGTGAAACAATAGTTCTAAAAGG No data
1124310019_1124310023 23 Left 1124310019 15:28614930-28614952 CCTCCAGTATTTGTTTATAAATT No data
Right 1124310023 15:28614976-28614998 TGTGAAACAATAGTTCTAAAAGG No data
1124310017_1124310023 29 Left 1124310017 15:28614924-28614946 CCTAGCCCTCCAGTATTTGTTTA No data
Right 1124310023 15:28614976-28614998 TGTGAAACAATAGTTCTAAAAGG No data
1124310022_1124310023 -10 Left 1124310022 15:28614963-28614985 CCAAAGTGTTTTCTGTGAAACAA No data
Right 1124310023 15:28614976-28614998 TGTGAAACAATAGTTCTAAAAGG No data
1124310020_1124310023 20 Left 1124310020 15:28614933-28614955 CCAGTATTTGTTTATAAATTAAA No data
Right 1124310023 15:28614976-28614998 TGTGAAACAATAGTTCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124310023 Original CRISPR TGTGAAACAATAGTTCTAAA AGG Intergenic
No off target data available for this crispr