ID: 1124311733

View in Genome Browser
Species Human (GRCh38)
Location 15:28631846-28631868
Sequence CCTGCTAACCAGACAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124311733_1124311738 -1 Left 1124311733 15:28631846-28631868 CCCTCTGCTGTCTGGTTAGCAGG No data
Right 1124311738 15:28631868-28631890 GAGGTACAATTTGTACAGGAAGG No data
1124311733_1124311737 -5 Left 1124311733 15:28631846-28631868 CCCTCTGCTGTCTGGTTAGCAGG No data
Right 1124311737 15:28631864-28631886 GCAGGAGGTACAATTTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124311733 Original CRISPR CCTGCTAACCAGACAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr