ID: 1124328814

View in Genome Browser
Species Human (GRCh38)
Location 15:28789522-28789544
Sequence CTGGTCCAGGGCGTGGGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124328814_1124328830 24 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328830 15:28789569-28789591 AGCTGGTTGGGGGCACCATCTGG No data
1124328814_1124328833 30 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328833 15:28789575-28789597 TTGGGGGCACCATCTGGACGGGG No data
1124328814_1124328819 -8 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328819 15:28789537-28789559 TGGACCAGCCGCCCAGATCATGG No data
1124328814_1124328824 7 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328824 15:28789552-28789574 GATCATGGCGCCGCAGCAGCTGG No data
1124328814_1124328826 12 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328826 15:28789557-28789579 TGGCGCCGCAGCAGCTGGTTGGG No data
1124328814_1124328827 13 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data
1124328814_1124328832 29 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328832 15:28789574-28789596 GTTGGGGGCACCATCTGGACGGG No data
1124328814_1124328825 11 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328825 15:28789556-28789578 ATGGCGCCGCAGCAGCTGGTTGG No data
1124328814_1124328831 28 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328831 15:28789573-28789595 GGTTGGGGGCACCATCTGGACGG No data
1124328814_1124328828 14 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328828 15:28789559-28789581 GCGCCGCAGCAGCTGGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124328814 Original CRISPR CTGGTCCAGGGCGTGGGTTG CGG (reversed) Intergenic
No off target data available for this crispr