ID: 1124328820

View in Genome Browser
Species Human (GRCh38)
Location 15:28789541-28789563
Sequence GGCGCCATGATCTGGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124328820_1124328830 5 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328830 15:28789569-28789591 AGCTGGTTGGGGGCACCATCTGG No data
1124328820_1124328828 -5 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328828 15:28789559-28789581 GCGCCGCAGCAGCTGGTTGGGGG No data
1124328820_1124328834 15 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328834 15:28789579-28789601 GGGCACCATCTGGACGGGGATGG No data
1124328820_1124328833 11 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328833 15:28789575-28789597 TTGGGGGCACCATCTGGACGGGG No data
1124328820_1124328836 24 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328836 15:28789588-28789610 CTGGACGGGGATGGTTCCCCAGG No data
1124328820_1124328826 -7 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328826 15:28789557-28789579 TGGCGCCGCAGCAGCTGGTTGGG No data
1124328820_1124328837 27 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328837 15:28789591-28789613 GACGGGGATGGTTCCCCAGGAGG No data
1124328820_1124328825 -8 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328825 15:28789556-28789578 ATGGCGCCGCAGCAGCTGGTTGG No data
1124328820_1124328832 10 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328832 15:28789574-28789596 GTTGGGGGCACCATCTGGACGGG No data
1124328820_1124328827 -6 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data
1124328820_1124328831 9 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328831 15:28789573-28789595 GGTTGGGGGCACCATCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124328820 Original CRISPR GGCGCCATGATCTGGGCGGC TGG (reversed) Intergenic
No off target data available for this crispr