ID: 1124328823

View in Genome Browser
Species Human (GRCh38)
Location 15:28789549-28789571
Sequence GCTGCTGCGGCGCCATGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124328823_1124328834 7 Left 1124328823 15:28789549-28789571 CCAGATCATGGCGCCGCAGCAGC No data
Right 1124328834 15:28789579-28789601 GGGCACCATCTGGACGGGGATGG No data
1124328823_1124328830 -3 Left 1124328823 15:28789549-28789571 CCAGATCATGGCGCCGCAGCAGC No data
Right 1124328830 15:28789569-28789591 AGCTGGTTGGGGGCACCATCTGG No data
1124328823_1124328833 3 Left 1124328823 15:28789549-28789571 CCAGATCATGGCGCCGCAGCAGC No data
Right 1124328833 15:28789575-28789597 TTGGGGGCACCATCTGGACGGGG No data
1124328823_1124328836 16 Left 1124328823 15:28789549-28789571 CCAGATCATGGCGCCGCAGCAGC No data
Right 1124328836 15:28789588-28789610 CTGGACGGGGATGGTTCCCCAGG No data
1124328823_1124328831 1 Left 1124328823 15:28789549-28789571 CCAGATCATGGCGCCGCAGCAGC No data
Right 1124328831 15:28789573-28789595 GGTTGGGGGCACCATCTGGACGG No data
1124328823_1124328837 19 Left 1124328823 15:28789549-28789571 CCAGATCATGGCGCCGCAGCAGC No data
Right 1124328837 15:28789591-28789613 GACGGGGATGGTTCCCCAGGAGG No data
1124328823_1124328832 2 Left 1124328823 15:28789549-28789571 CCAGATCATGGCGCCGCAGCAGC No data
Right 1124328832 15:28789574-28789596 GTTGGGGGCACCATCTGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124328823 Original CRISPR GCTGCTGCGGCGCCATGATC TGG (reversed) Intergenic
No off target data available for this crispr