ID: 1124328827

View in Genome Browser
Species Human (GRCh38)
Location 15:28789558-28789580
Sequence GGCGCCGCAGCAGCTGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124328816_1124328827 6 Left 1124328816 15:28789529-28789551 CCACGCCCTGGACCAGCCGCCCA No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data
1124328817_1124328827 1 Left 1124328817 15:28789534-28789556 CCCTGGACCAGCCGCCCAGATCA No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data
1124328811_1124328827 23 Left 1124328811 15:28789512-28789534 CCTCCACGATCCGCAACCCACGC No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data
1124328818_1124328827 0 Left 1124328818 15:28789535-28789557 CCTGGACCAGCCGCCCAGATCAT No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data
1124328809_1124328827 30 Left 1124328809 15:28789505-28789527 CCTCTTCCCTCCACGATCCGCAA No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data
1124328812_1124328827 20 Left 1124328812 15:28789515-28789537 CCACGATCCGCAACCCACGCCCT No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data
1124328810_1124328827 24 Left 1124328810 15:28789511-28789533 CCCTCCACGATCCGCAACCCACG No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data
1124328815_1124328827 7 Left 1124328815 15:28789528-28789550 CCCACGCCCTGGACCAGCCGCCC No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data
1124328814_1124328827 13 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data
1124328821_1124328827 -10 Left 1124328821 15:28789545-28789567 CCGCCCAGATCATGGCGCCGCAG No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data
1124328820_1124328827 -6 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328827 15:28789558-28789580 GGCGCCGCAGCAGCTGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124328827 Original CRISPR GGCGCCGCAGCAGCTGGTTG GGG Intergenic
No off target data available for this crispr