ID: 1124328829

View in Genome Browser
Species Human (GRCh38)
Location 15:28789562-28789584
Sequence GTGCCCCCAACCAGCTGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124328829_1124328837 6 Left 1124328829 15:28789562-28789584 CCGCAGCAGCTGGTTGGGGGCAC No data
Right 1124328837 15:28789591-28789613 GACGGGGATGGTTCCCCAGGAGG No data
1124328829_1124328834 -6 Left 1124328829 15:28789562-28789584 CCGCAGCAGCTGGTTGGGGGCAC No data
Right 1124328834 15:28789579-28789601 GGGCACCATCTGGACGGGGATGG No data
1124328829_1124328836 3 Left 1124328829 15:28789562-28789584 CCGCAGCAGCTGGTTGGGGGCAC No data
Right 1124328836 15:28789588-28789610 CTGGACGGGGATGGTTCCCCAGG No data
1124328829_1124328841 28 Left 1124328829 15:28789562-28789584 CCGCAGCAGCTGGTTGGGGGCAC No data
Right 1124328841 15:28789613-28789635 GAGACCCTCCCCTGCCTCCGAGG No data
1124328829_1124328833 -10 Left 1124328829 15:28789562-28789584 CCGCAGCAGCTGGTTGGGGGCAC No data
Right 1124328833 15:28789575-28789597 TTGGGGGCACCATCTGGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124328829 Original CRISPR GTGCCCCCAACCAGCTGCTG CGG (reversed) Intergenic
No off target data available for this crispr