ID: 1124328831

View in Genome Browser
Species Human (GRCh38)
Location 15:28789573-28789595
Sequence GGTTGGGGGCACCATCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124328817_1124328831 16 Left 1124328817 15:28789534-28789556 CCCTGGACCAGCCGCCCAGATCA No data
Right 1124328831 15:28789573-28789595 GGTTGGGGGCACCATCTGGACGG No data
1124328818_1124328831 15 Left 1124328818 15:28789535-28789557 CCTGGACCAGCCGCCCAGATCAT No data
Right 1124328831 15:28789573-28789595 GGTTGGGGGCACCATCTGGACGG No data
1124328820_1124328831 9 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328831 15:28789573-28789595 GGTTGGGGGCACCATCTGGACGG No data
1124328814_1124328831 28 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328831 15:28789573-28789595 GGTTGGGGGCACCATCTGGACGG No data
1124328815_1124328831 22 Left 1124328815 15:28789528-28789550 CCCACGCCCTGGACCAGCCGCCC No data
Right 1124328831 15:28789573-28789595 GGTTGGGGGCACCATCTGGACGG No data
1124328822_1124328831 2 Left 1124328822 15:28789548-28789570 CCCAGATCATGGCGCCGCAGCAG No data
Right 1124328831 15:28789573-28789595 GGTTGGGGGCACCATCTGGACGG No data
1124328823_1124328831 1 Left 1124328823 15:28789549-28789571 CCAGATCATGGCGCCGCAGCAGC No data
Right 1124328831 15:28789573-28789595 GGTTGGGGGCACCATCTGGACGG No data
1124328821_1124328831 5 Left 1124328821 15:28789545-28789567 CCGCCCAGATCATGGCGCCGCAG No data
Right 1124328831 15:28789573-28789595 GGTTGGGGGCACCATCTGGACGG No data
1124328816_1124328831 21 Left 1124328816 15:28789529-28789551 CCACGCCCTGGACCAGCCGCCCA No data
Right 1124328831 15:28789573-28789595 GGTTGGGGGCACCATCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124328831 Original CRISPR GGTTGGGGGCACCATCTGGA CGG Intergenic
No off target data available for this crispr