ID: 1124328832

View in Genome Browser
Species Human (GRCh38)
Location 15:28789574-28789596
Sequence GTTGGGGGCACCATCTGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124328820_1124328832 10 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328832 15:28789574-28789596 GTTGGGGGCACCATCTGGACGGG No data
1124328817_1124328832 17 Left 1124328817 15:28789534-28789556 CCCTGGACCAGCCGCCCAGATCA No data
Right 1124328832 15:28789574-28789596 GTTGGGGGCACCATCTGGACGGG No data
1124328815_1124328832 23 Left 1124328815 15:28789528-28789550 CCCACGCCCTGGACCAGCCGCCC No data
Right 1124328832 15:28789574-28789596 GTTGGGGGCACCATCTGGACGGG No data
1124328814_1124328832 29 Left 1124328814 15:28789522-28789544 CCGCAACCCACGCCCTGGACCAG No data
Right 1124328832 15:28789574-28789596 GTTGGGGGCACCATCTGGACGGG No data
1124328822_1124328832 3 Left 1124328822 15:28789548-28789570 CCCAGATCATGGCGCCGCAGCAG No data
Right 1124328832 15:28789574-28789596 GTTGGGGGCACCATCTGGACGGG No data
1124328818_1124328832 16 Left 1124328818 15:28789535-28789557 CCTGGACCAGCCGCCCAGATCAT No data
Right 1124328832 15:28789574-28789596 GTTGGGGGCACCATCTGGACGGG No data
1124328823_1124328832 2 Left 1124328823 15:28789549-28789571 CCAGATCATGGCGCCGCAGCAGC No data
Right 1124328832 15:28789574-28789596 GTTGGGGGCACCATCTGGACGGG No data
1124328816_1124328832 22 Left 1124328816 15:28789529-28789551 CCACGCCCTGGACCAGCCGCCCA No data
Right 1124328832 15:28789574-28789596 GTTGGGGGCACCATCTGGACGGG No data
1124328821_1124328832 6 Left 1124328821 15:28789545-28789567 CCGCCCAGATCATGGCGCCGCAG No data
Right 1124328832 15:28789574-28789596 GTTGGGGGCACCATCTGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124328832 Original CRISPR GTTGGGGGCACCATCTGGAC GGG Intergenic
No off target data available for this crispr