ID: 1124328836

View in Genome Browser
Species Human (GRCh38)
Location 15:28789588-28789610
Sequence CTGGACGGGGATGGTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124328821_1124328836 20 Left 1124328821 15:28789545-28789567 CCGCCCAGATCATGGCGCCGCAG No data
Right 1124328836 15:28789588-28789610 CTGGACGGGGATGGTTCCCCAGG No data
1124328818_1124328836 30 Left 1124328818 15:28789535-28789557 CCTGGACCAGCCGCCCAGATCAT No data
Right 1124328836 15:28789588-28789610 CTGGACGGGGATGGTTCCCCAGG No data
1124328820_1124328836 24 Left 1124328820 15:28789541-28789563 CCAGCCGCCCAGATCATGGCGCC No data
Right 1124328836 15:28789588-28789610 CTGGACGGGGATGGTTCCCCAGG No data
1124328822_1124328836 17 Left 1124328822 15:28789548-28789570 CCCAGATCATGGCGCCGCAGCAG No data
Right 1124328836 15:28789588-28789610 CTGGACGGGGATGGTTCCCCAGG No data
1124328829_1124328836 3 Left 1124328829 15:28789562-28789584 CCGCAGCAGCTGGTTGGGGGCAC No data
Right 1124328836 15:28789588-28789610 CTGGACGGGGATGGTTCCCCAGG No data
1124328823_1124328836 16 Left 1124328823 15:28789549-28789571 CCAGATCATGGCGCCGCAGCAGC No data
Right 1124328836 15:28789588-28789610 CTGGACGGGGATGGTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124328836 Original CRISPR CTGGACGGGGATGGTTCCCC AGG Intergenic
No off target data available for this crispr