ID: 1124333528

View in Genome Browser
Species Human (GRCh38)
Location 15:28840562-28840584
Sequence GCTGCATCCCCTCCTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124333528_1124333529 -4 Left 1124333528 15:28840562-28840584 CCAGGAGGAGGAGGGGATGCAGC No data
Right 1124333529 15:28840581-28840603 CAGCCACCAGTCCCCACTCCTGG No data
1124333528_1124333537 19 Left 1124333528 15:28840562-28840584 CCAGGAGGAGGAGGGGATGCAGC No data
Right 1124333537 15:28840604-28840626 GAGTCGTATTTCTGAAAGCTTGG No data
1124333528_1124333530 -3 Left 1124333528 15:28840562-28840584 CCAGGAGGAGGAGGGGATGCAGC No data
Right 1124333530 15:28840582-28840604 AGCCACCAGTCCCCACTCCTGGG No data
1124333528_1124333538 20 Left 1124333528 15:28840562-28840584 CCAGGAGGAGGAGGGGATGCAGC No data
Right 1124333538 15:28840605-28840627 AGTCGTATTTCTGAAAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124333528 Original CRISPR GCTGCATCCCCTCCTCCTCC TGG (reversed) Intergenic
No off target data available for this crispr