ID: 1124333531

View in Genome Browser
Species Human (GRCh38)
Location 15:28840584-28840606
Sequence CTCCCAGGAGTGGGGACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124333531_1124333542 27 Left 1124333531 15:28840584-28840606 CCACCAGTCCCCACTCCTGGGAG No data
Right 1124333542 15:28840634-28840656 GTAAATATTAGGCTGTGGGCTGG No data
1124333531_1124333539 16 Left 1124333531 15:28840584-28840606 CCACCAGTCCCCACTCCTGGGAG No data
Right 1124333539 15:28840623-28840645 TTGGGTATACAGTAAATATTAGG No data
1124333531_1124333541 23 Left 1124333531 15:28840584-28840606 CCACCAGTCCCCACTCCTGGGAG No data
Right 1124333541 15:28840630-28840652 TACAGTAAATATTAGGCTGTGGG No data
1124333531_1124333537 -3 Left 1124333531 15:28840584-28840606 CCACCAGTCCCCACTCCTGGGAG No data
Right 1124333537 15:28840604-28840626 GAGTCGTATTTCTGAAAGCTTGG No data
1124333531_1124333538 -2 Left 1124333531 15:28840584-28840606 CCACCAGTCCCCACTCCTGGGAG No data
Right 1124333538 15:28840605-28840627 AGTCGTATTTCTGAAAGCTTGGG No data
1124333531_1124333540 22 Left 1124333531 15:28840584-28840606 CCACCAGTCCCCACTCCTGGGAG No data
Right 1124333540 15:28840629-28840651 ATACAGTAAATATTAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124333531 Original CRISPR CTCCCAGGAGTGGGGACTGG TGG (reversed) Intergenic
No off target data available for this crispr