ID: 1124333532

View in Genome Browser
Species Human (GRCh38)
Location 15:28840587-28840609
Sequence CGACTCCCAGGAGTGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124333532_1124333541 20 Left 1124333532 15:28840587-28840609 CCAGTCCCCACTCCTGGGAGTCG No data
Right 1124333541 15:28840630-28840652 TACAGTAAATATTAGGCTGTGGG No data
1124333532_1124333537 -6 Left 1124333532 15:28840587-28840609 CCAGTCCCCACTCCTGGGAGTCG No data
Right 1124333537 15:28840604-28840626 GAGTCGTATTTCTGAAAGCTTGG No data
1124333532_1124333540 19 Left 1124333532 15:28840587-28840609 CCAGTCCCCACTCCTGGGAGTCG No data
Right 1124333540 15:28840629-28840651 ATACAGTAAATATTAGGCTGTGG No data
1124333532_1124333542 24 Left 1124333532 15:28840587-28840609 CCAGTCCCCACTCCTGGGAGTCG No data
Right 1124333542 15:28840634-28840656 GTAAATATTAGGCTGTGGGCTGG No data
1124333532_1124333539 13 Left 1124333532 15:28840587-28840609 CCAGTCCCCACTCCTGGGAGTCG No data
Right 1124333539 15:28840623-28840645 TTGGGTATACAGTAAATATTAGG No data
1124333532_1124333538 -5 Left 1124333532 15:28840587-28840609 CCAGTCCCCACTCCTGGGAGTCG No data
Right 1124333538 15:28840605-28840627 AGTCGTATTTCTGAAAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124333532 Original CRISPR CGACTCCCAGGAGTGGGGAC TGG (reversed) Intergenic
No off target data available for this crispr