ID: 1124333537

View in Genome Browser
Species Human (GRCh38)
Location 15:28840604-28840626
Sequence GAGTCGTATTTCTGAAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124333532_1124333537 -6 Left 1124333532 15:28840587-28840609 CCAGTCCCCACTCCTGGGAGTCG No data
Right 1124333537 15:28840604-28840626 GAGTCGTATTTCTGAAAGCTTGG No data
1124333528_1124333537 19 Left 1124333528 15:28840562-28840584 CCAGGAGGAGGAGGGGATGCAGC No data
Right 1124333537 15:28840604-28840626 GAGTCGTATTTCTGAAAGCTTGG No data
1124333531_1124333537 -3 Left 1124333531 15:28840584-28840606 CCACCAGTCCCCACTCCTGGGAG No data
Right 1124333537 15:28840604-28840626 GAGTCGTATTTCTGAAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124333537 Original CRISPR GAGTCGTATTTCTGAAAGCT TGG Intergenic
No off target data available for this crispr