ID: 1124335823

View in Genome Browser
Species Human (GRCh38)
Location 15:28856392-28856414
Sequence CAGACCACACTGGCCATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124335810_1124335823 14 Left 1124335810 15:28856355-28856377 CCCCAGACCCTAAACTCACTGTC 0: 1
1: 2
2: 1
3: 18
4: 154
Right 1124335823 15:28856392-28856414 CAGACCACACTGGCCATTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 136
1124335812_1124335823 12 Left 1124335812 15:28856357-28856379 CCAGACCCTAAACTCACTGTCCT 0: 1
1: 2
2: 0
3: 14
4: 183
Right 1124335823 15:28856392-28856414 CAGACCACACTGGCCATTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 136
1124335818_1124335823 -8 Left 1124335818 15:28856377-28856399 CCTGCTCGGGGACCCCAGACCAC 0: 1
1: 0
2: 0
3: 17
4: 149
Right 1124335823 15:28856392-28856414 CAGACCACACTGGCCATTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 136
1124335811_1124335823 13 Left 1124335811 15:28856356-28856378 CCCAGACCCTAAACTCACTGTCC 0: 1
1: 2
2: 0
3: 9
4: 141
Right 1124335823 15:28856392-28856414 CAGACCACACTGGCCATTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 136
1124335808_1124335823 28 Left 1124335808 15:28856341-28856363 CCATAGCACCTGAGCCCCAGACC 0: 1
1: 1
2: 3
3: 30
4: 279
Right 1124335823 15:28856392-28856414 CAGACCACACTGGCCATTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 136
1124335813_1124335823 7 Left 1124335813 15:28856362-28856384 CCCTAAACTCACTGTCCTGCTCG 0: 1
1: 2
2: 0
3: 8
4: 95
Right 1124335823 15:28856392-28856414 CAGACCACACTGGCCATTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 136
1124335814_1124335823 6 Left 1124335814 15:28856363-28856385 CCTAAACTCACTGTCCTGCTCGG No data
Right 1124335823 15:28856392-28856414 CAGACCACACTGGCCATTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 136
1124335809_1124335823 20 Left 1124335809 15:28856349-28856371 CCTGAGCCCCAGACCCTAAACTC 0: 1
1: 1
2: 3
3: 24
4: 244
Right 1124335823 15:28856392-28856414 CAGACCACACTGGCCATTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124335823 Original CRISPR CAGACCACACTGGCCATTGA AGG Intergenic