ID: 1124336127

View in Genome Browser
Species Human (GRCh38)
Location 15:28858436-28858458
Sequence ACAACGGTGTTGGCTGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124336124_1124336127 -10 Left 1124336124 15:28858423-28858445 CCTTATTTCTAACACAACGGTGT 0: 1
1: 0
2: 0
3: 14
4: 79
Right 1124336127 15:28858436-28858458 ACAACGGTGTTGGCTGGTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124336127 Original CRISPR ACAACGGTGTTGGCTGGTCC TGG Intergenic
903613101 1:24631351-24631373 AAAAGAGTGTTGGCTGGTCATGG - Intergenic
905248386 1:36630308-36630330 GAAACAATGTTGGCTGGTCCAGG - Intergenic
906192939 1:43910271-43910293 GCAGCTGTGCTGGCTGGTCCAGG - Intronic
906573263 1:46862703-46862725 GCACCAGTGTTGGCTGCTCCAGG - Intergenic
909831589 1:80198196-80198218 ATAAAGGTGTTGGCAGGGCCAGG + Intergenic
910325904 1:86006919-86006941 ACAACAATGTGGGCTGGTTCTGG + Intronic
920310004 1:205043362-205043384 AGAAGGGTGTTGGCTGGGGCAGG - Exonic
924592726 1:245419101-245419123 ACAACGGTATTTGGTGGTGCTGG - Intronic
1066293437 10:34034273-34034295 ACAACTGTCTAGGGTGGTCCAGG - Intergenic
1067377885 10:45744483-45744505 CCAAATGTGGTGGCTGGTCCTGG - Intronic
1067885585 10:50085160-50085182 CCAAATGTGGTGGCTGGTCCTGG - Intronic
1071660725 10:87499930-87499952 ACAACAGTGTTGGTTTGTGCAGG + Intergenic
1075126366 10:119703258-119703280 ATCAAGGTGTTGGCTGGGCCAGG - Intergenic
1076533807 10:131163069-131163091 GCAATGGCGTTGTCTGGTCCTGG - Intronic
1076601383 10:131658978-131659000 ACAACGGAGTGGGCAGGTGCAGG + Intergenic
1077028553 11:452576-452598 GCAGCGGGGCTGGCTGGTCCAGG + Intronic
1078725254 11:13924307-13924329 ACAACTTAGTTGGCTGCTCCAGG + Intergenic
1088829408 11:113522497-113522519 ACAACTGTGTTGTCAGGCCCTGG - Intergenic
1089739128 11:120570042-120570064 AAAATGGTGTTGGCTGCTCCGGG + Intronic
1092164719 12:6335950-6335972 GGCACGGTGTTGGCTGGTGCGGG - Intronic
1092926052 12:13273416-13273438 ACAAGGGTGTTGTGAGGTCCAGG + Intergenic
1093014949 12:14146230-14146252 TCAAAGGTGTGGGCTGGTACAGG + Intergenic
1096561097 12:52436590-52436612 ACAAAGGTCTTGGAGGGTCCAGG + Intergenic
1096731247 12:53614788-53614810 AAAATGGTGTTGGCTGGGCGTGG + Intronic
1096966023 12:55628440-55628462 AGAAGGATATTGGCTGGTCCAGG - Intergenic
1100603821 12:96134648-96134670 ACAAAGGTATTGGCTGGGCACGG + Intergenic
1100776507 12:97980025-97980047 GCACTGGTGTTGGCAGGTCCAGG - Intergenic
1104859903 12:131918446-131918468 GCCACGGTGTCTGCTGGTCCTGG + Intronic
1124336127 15:28858436-28858458 ACAACGGTGTTGGCTGGTCCTGG + Intergenic
1127143649 15:56002626-56002648 ATAAGGGTGTTGGCTGGGCGCGG - Intergenic
1135113325 16:19707493-19707515 GCAGTGGTGTTGGCTGGACCTGG - Intronic
1135162843 16:20112746-20112768 AAAACGGACTTGGCTGCTCCAGG - Intergenic
1137009978 16:35312037-35312059 ACCACCCTGTTGGCTGGGCCTGG - Intergenic
1137527790 16:49251341-49251363 ACCAAGGTGTTGGCAGGGCCAGG + Intergenic
1143105356 17:4527230-4527252 ACAATGTTCTTGGCTGTTCCTGG - Intronic
1144263442 17:13545592-13545614 ACACCAGTGTTTGCTGATCCTGG + Intronic
1150603027 17:66667018-66667040 ACAAAGGAGTTGGCTGGACAGGG - Intronic
1150616749 17:66778221-66778243 AAAACGGTGATGGCTGGGCCCGG + Intronic
1155266953 18:24103725-24103747 AAAACAGTGTTGGCTGGGACTGG - Intronic
1155610789 18:27665207-27665229 AAAATGGTGTTTGTTGGTCCTGG - Intergenic
1157820918 18:50767720-50767742 ACATTGGTGTTAGCAGGTCCAGG - Intergenic
1158104657 18:53871901-53871923 ACAAAGGCGTTTGCTGATCCAGG - Intergenic
1158932058 18:62332181-62332203 ACCACTGTGTTGGCTGGTTTGGG + Intronic
1162769982 19:12943624-12943646 ACAAAGGTGAGGCCTGGTCCTGG + Exonic
1165169630 19:33882600-33882622 ACAGCCATGTTAGCTGGTCCAGG - Intergenic
930196774 2:48518329-48518351 ACAATGGAGGTGGCTGGTCTGGG - Intergenic
939007457 2:136805912-136805934 ACAAAGGTGTTGGCTGGAAGTGG - Intronic
941450588 2:165655658-165655680 ACCAAGGTGTTGGCAGGGCCCGG + Intronic
946904765 2:224405700-224405722 AAAACCGTGGTGGCTAGTCCAGG + Intergenic
1171837259 20:30168468-30168490 GCCACGGTGGTGGCTGGACCCGG + Intergenic
1176248555 20:64109282-64109304 ACCAGGGTGTGGGCTGGGCCAGG + Intergenic
1177943470 21:27439804-27439826 ACAACTGTGTTGTCTGGTTTAGG + Intergenic
1178995956 21:37400043-37400065 ACCAAGGTGTTGGCAGGGCCAGG + Intronic
950426436 3:12927111-12927133 AGAAGGGTGTGGGCTGGTGCTGG - Intronic
951449538 3:22820761-22820783 AAAACCGTGTTGGCTGTTCCTGG - Intergenic
952452201 3:33442642-33442664 ATAAAAGTGTTGGCTGGTCATGG + Intergenic
956055957 3:65299164-65299186 AAAAAGGAGTTGGCTGGTCATGG - Intergenic
962946434 3:140174914-140174936 ATCAAGGTGTTGGCAGGTCCAGG + Intronic
969809130 4:9634316-9634338 ACCACGGTGTTGACTGGTGTTGG + Intergenic
969854639 4:9989362-9989384 AGAAGGGTGTTGGATGGACCAGG - Intronic
970332002 4:14996109-14996131 GCAACGATGTAGCCTGGTCCAGG + Intergenic
972667713 4:41183206-41183228 ACAATGGTGATTGCTGGGCCAGG - Intronic
988507109 5:31833176-31833198 ACAAAGGTGGAGGCTGGGCCTGG + Intronic
992378663 5:76215867-76215889 ACAAAGGTGTTCGCTGTTTCTGG + Intronic
995716424 5:115085569-115085591 ACAGCTCTGTTGGCTGGTCAGGG + Intergenic
997528501 5:134568414-134568436 ACCCCAGTGTTGGCTGGTTCAGG + Intronic
997531629 5:134584948-134584970 ACACCTGTGTCGGCTGGGCCAGG + Intergenic
1006311830 6:33266519-33266541 ACAAAGGTGTTGAATGGTACAGG + Intronic
1007960288 6:45952705-45952727 AAAGGGGTGTTGGCTGGACCAGG + Intronic
1012982756 6:105847260-105847282 ACAAGGGTTTTGGCTGGGCACGG + Intergenic
1018172054 6:161151342-161151364 AGACCGGTGTTGGCTGTTCTTGG + Intronic
1024083178 7:45872819-45872841 ACAAAGCTGTGGCCTGGTCCTGG - Intergenic
1030097184 7:105910765-105910787 CCACTGGTGTTGGCTGGTCACGG - Intronic
1034475997 7:151282346-151282368 ACAGAGGTGTGGGCTTGTCCTGG + Intergenic
1035821356 8:2595569-2595591 TCCACGGTGCTGGCTGCTCCTGG + Intergenic
1037140859 8:15519040-15519062 ACAACAGTGTTGTGTGGTCCTGG + Intronic
1039448068 8:37648449-37648471 ACATCGTTGTTGGCTGCTTCTGG + Intergenic
1046152120 8:110241011-110241033 ACAACGCTGTTGGCTGGGCGTGG - Intergenic
1048167632 8:132077410-132077432 ACAACTGTGATGGATGGACCCGG - Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050339830 9:4625386-4625408 TCAACTGAGCTGGCTGGTCCTGG + Exonic
1055796155 9:79976953-79976975 ACAACAGAGTTGGGTGGTTCCGG + Intergenic
1057199366 9:93132204-93132226 ACAGGTGTGTTGGGTGGTCCTGG + Intronic
1058877299 9:109255615-109255637 CCAAAGGTGTTTGCAGGTCCTGG + Exonic
1061079542 9:128361738-128361760 ACAGCTGTGTTGACTGTTCCAGG - Intergenic
1062506637 9:136880903-136880925 GCAACCGTGGTGACTGGTCCTGG + Intronic
1197932338 X:131708937-131708959 ACAACAGAGTTGGCTGGGCATGG - Intergenic
1200470277 Y:3578262-3578284 ACAAAGATTTTGGCTGGTCGTGG + Intergenic