ID: 1124337140

View in Genome Browser
Species Human (GRCh38)
Location 15:28865986-28866008
Sequence ACAGGCCTGAGCCACCATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124337126_1124337140 26 Left 1124337126 15:28865937-28865959 CCTGACCTCAGGTGATCCGCCTG 0: 5878
1: 38418
2: 78946
3: 108767
4: 107371
Right 1124337140 15:28865986-28866008 ACAGGCCTGAGCCACCATGACGG No data
1124337134_1124337140 -3 Left 1124337134 15:28865966-28865988 CCCCCCAAAATGCTGGGATGACA 0: 144
1: 17037
2: 318349
3: 266323
4: 201102
Right 1124337140 15:28865986-28866008 ACAGGCCTGAGCCACCATGACGG No data
1124337136_1124337140 -5 Left 1124337136 15:28865968-28865990 CCCCAAAATGCTGGGATGACAGG No data
Right 1124337140 15:28865986-28866008 ACAGGCCTGAGCCACCATGACGG No data
1124337132_1124337140 3 Left 1124337132 15:28865960-28865982 CCTTGGCCCCCCAAAATGCTGGG 0: 42
1: 5103
2: 93667
3: 215549
4: 236408
Right 1124337140 15:28865986-28866008 ACAGGCCTGAGCCACCATGACGG No data
1124337138_1124337140 -6 Left 1124337138 15:28865969-28865991 CCCAAAATGCTGGGATGACAGGC 0: 97
1: 12186
2: 242112
3: 279464
4: 222799
Right 1124337140 15:28865986-28866008 ACAGGCCTGAGCCACCATGACGG No data
1124337139_1124337140 -7 Left 1124337139 15:28865970-28865992 CCAAAATGCTGGGATGACAGGCC No data
Right 1124337140 15:28865986-28866008 ACAGGCCTGAGCCACCATGACGG No data
1124337135_1124337140 -4 Left 1124337135 15:28865967-28865989 CCCCCAAAATGCTGGGATGACAG No data
Right 1124337140 15:28865986-28866008 ACAGGCCTGAGCCACCATGACGG No data
1124337130_1124337140 7 Left 1124337130 15:28865956-28865978 CCTGCCTTGGCCCCCCAAAATGC 0: 20
1: 3670
2: 68317
3: 186086
4: 233908
Right 1124337140 15:28865986-28866008 ACAGGCCTGAGCCACCATGACGG No data
1124337129_1124337140 10 Left 1124337129 15:28865953-28865975 CCGCCTGCCTTGGCCCCCCAAAA 0: 16
1: 1965
2: 31312
3: 83225
4: 159393
Right 1124337140 15:28865986-28866008 ACAGGCCTGAGCCACCATGACGG No data
1124337127_1124337140 21 Left 1124337127 15:28865942-28865964 CCTCAGGTGATCCGCCTGCCTTG 0: 1871
1: 15320
2: 44950
3: 78720
4: 96280
Right 1124337140 15:28865986-28866008 ACAGGCCTGAGCCACCATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124337140 Original CRISPR ACAGGCCTGAGCCACCATGA CGG Intergenic
No off target data available for this crispr