ID: 1124341782

View in Genome Browser
Species Human (GRCh38)
Location 15:28894543-28894565
Sequence GGCAAAGGGCCAGCCTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 1, 2: 5, 3: 23, 4: 282}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124341773_1124341782 -2 Left 1124341773 15:28894522-28894544 CCAGGCCAGAAGAGCCCTCCAGG 0: 1
1: 0
2: 5
3: 27
4: 305
Right 1124341782 15:28894543-28894565 GGCAAAGGGCCAGCCTGGAATGG 0: 1
1: 1
2: 5
3: 23
4: 282
1124341770_1124341782 9 Left 1124341770 15:28894511-28894533 CCCTTCAGAGCCCAGGCCAGAAG 0: 3
1: 0
2: 3
3: 30
4: 316
Right 1124341782 15:28894543-28894565 GGCAAAGGGCCAGCCTGGAATGG 0: 1
1: 1
2: 5
3: 23
4: 282
1124341771_1124341782 8 Left 1124341771 15:28894512-28894534 CCTTCAGAGCCCAGGCCAGAAGA 0: 2
1: 0
2: 3
3: 33
4: 285
Right 1124341782 15:28894543-28894565 GGCAAAGGGCCAGCCTGGAATGG 0: 1
1: 1
2: 5
3: 23
4: 282
1124341775_1124341782 -7 Left 1124341775 15:28894527-28894549 CCAGAAGAGCCCTCCAGGCAAAG 0: 2
1: 0
2: 3
3: 14
4: 143
Right 1124341782 15:28894543-28894565 GGCAAAGGGCCAGCCTGGAATGG 0: 1
1: 1
2: 5
3: 23
4: 282
1124341769_1124341782 10 Left 1124341769 15:28894510-28894532 CCCCTTCAGAGCCCAGGCCAGAA 0: 2
1: 1
2: 1
3: 28
4: 292
Right 1124341782 15:28894543-28894565 GGCAAAGGGCCAGCCTGGAATGG 0: 1
1: 1
2: 5
3: 23
4: 282
1124341772_1124341782 -1 Left 1124341772 15:28894521-28894543 CCCAGGCCAGAAGAGCCCTCCAG 0: 2
1: 0
2: 4
3: 40
4: 343
Right 1124341782 15:28894543-28894565 GGCAAAGGGCCAGCCTGGAATGG 0: 1
1: 1
2: 5
3: 23
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124341782 Original CRISPR GGCAAAGGGCCAGCCTGGAA TGG Intronic
900329074 1:2125029-2125051 GGCACAGAGCCAGGCTGGCAAGG - Intronic
901445870 1:9307877-9307899 GGCACAGGGTAAGCCTGGGAGGG - Intronic
901762702 1:11480848-11480870 GGCAGAAGCCCAGCCTGGACAGG + Intronic
902664465 1:17927787-17927809 GGGAAAGGGCGTCCCTGGAAGGG + Intergenic
903453393 1:23470414-23470436 GGCCAAGGGCCACCTTGGTATGG - Intronic
903977434 1:27159988-27160010 GGCCAAGGCCCAGCCTGGGCAGG + Intronic
904170844 1:28591514-28591536 TCCAGAAGGCCAGCCTGGAAAGG + Intronic
904208507 1:28870732-28870754 GAGGAAGGGACAGCCTGGAAAGG + Intergenic
904266993 1:29323838-29323860 GGCAGAGGTCCAGTCTGAAAGGG + Intronic
904370095 1:30042801-30042823 GGCCATGGGCAGGCCTGGAAAGG - Intergenic
904384931 1:30134983-30135005 GGCAGAGGGCCGGGGTGGAAAGG + Intergenic
905127468 1:35725659-35725681 CACAAAGGGCCAGCCTGAATGGG + Intronic
905268870 1:36773619-36773641 GGGAAAGGGCCAGCATAAAATGG - Intergenic
905593854 1:39188577-39188599 AGCAATTGGCCAGTCTGGAAGGG + Intronic
906264174 1:44416504-44416526 GGCACAGGGGCAGCCTGAAGAGG - Intronic
907589852 1:55655707-55655729 GGCAAGGGGCTAGAGTGGAATGG - Intergenic
908721848 1:67134288-67134310 GCCAACGCGCCGGCCTGGAAGGG + Intronic
909038487 1:70622561-70622583 GGCCAAGGGCCAGCATGGTGGGG + Intergenic
911050902 1:93670373-93670395 GGCAGAAGGCAGGCCTGGAAGGG - Intronic
911065575 1:93785011-93785033 CCAAAAGGGCCAGCCTGGAAGGG + Intronic
911086983 1:93987280-93987302 GGCAAGGGGTCAATCTGGAAGGG + Intergenic
913714923 1:121523773-121523795 GGCAAGAGGGCAGCCTGGTATGG + Intergenic
915355723 1:155254471-155254493 GGCACAGGCTCAGCCTGGCAGGG + Intronic
916175210 1:162032205-162032227 GGCAGAGAGCCAGCCAGCAATGG - Intergenic
916354268 1:163886758-163886780 TTCAAACAGCCAGCCTGGAAAGG + Intergenic
917191664 1:172424926-172424948 GCCACAGGGCCAGCCTGGAGTGG + Intronic
919158533 1:193799591-193799613 GGATATGGGCCACCCTGGAAGGG + Intergenic
924205856 1:241710748-241710770 GGCATGGGGTGAGCCTGGAAGGG + Intronic
1063365126 10:5486036-5486058 GGCAGAGAGCCGGCCTGGGAAGG + Intergenic
1063494363 10:6493058-6493080 GGTCAAGGTCCAGGCTGGAAGGG + Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1066289359 10:33999681-33999703 GGCAAAATGGCAGCCTGGTAAGG - Intergenic
1066522455 10:36237646-36237668 CGCAAAAGGCCAGCCTGAAATGG + Intergenic
1067052116 10:43027715-43027737 GGCACAAGGCCAGCCTGGATGGG - Intergenic
1067582477 10:47454323-47454345 GGCAAAGCTCAAGCCTGGGAAGG - Intergenic
1069947603 10:71998658-71998680 GGCTAAGGGCCAGCCTGGCAGGG - Intronic
1070641725 10:78175249-78175271 GGCAGAGAGCCAGTCTGGATGGG + Intergenic
1071505063 10:86227182-86227204 GGGAAAGGAGAAGCCTGGAAAGG + Intronic
1071598861 10:86946537-86946559 GGTGAAGGGCCAGGATGGAAGGG - Intronic
1071718646 10:88121087-88121109 GGAGAAGGACCAGGCTGGAAGGG + Intergenic
1073096796 10:100984782-100984804 GGGAACGGGCCAGCCTGGGGAGG + Exonic
1074135809 10:110625654-110625676 GGCAGAGGCCCAGCCTAGCATGG - Intergenic
1074634242 10:115295532-115295554 GGCCAAGGGCCTGCCTGGAGAGG + Intronic
1075624414 10:123951202-123951224 GGCAAAGAACCAGCTGGGAAGGG - Intergenic
1075711300 10:124532093-124532115 GTCACAGGGCCAGCCTGAAGGGG - Intronic
1076519377 10:131071169-131071191 GCAGAAGGGCCAGCCTGGAGTGG + Intergenic
1076890373 10:133280461-133280483 GCCAAACTGCCAGCCTGGAAGGG - Intronic
1077244141 11:1527875-1527897 GGCCAGGGGGCAGCCTGGGAGGG - Intergenic
1078508081 11:11966703-11966725 TGCAAAAGCCCAGTCTGGAATGG - Intronic
1079249736 11:18778719-18778741 GGCACATGGCCAGCCTGTACAGG - Intronic
1081616575 11:44594901-44594923 GTCAAAGGACCAGCTGGGAATGG - Intronic
1081637786 11:44732186-44732208 GGCAGAGGCCCAGCCTGGCCTGG - Intronic
1082843696 11:57710596-57710618 GACAAAGGGCCAGCCATGTATGG - Intronic
1083652086 11:64209617-64209639 GGGAAGGGCCCAGCCTGGGAGGG + Intronic
1083959618 11:66007342-66007364 AGGGAGGGGCCAGCCTGGAAAGG - Intergenic
1084447367 11:69211686-69211708 AGCAAAGGGCCCGCATGTAACGG + Intergenic
1084744864 11:71163327-71163349 GGCACAGGGTCTGCCTGTAATGG + Intronic
1085283344 11:75344885-75344907 GGCCCAGGGCCAGCATGAAAGGG + Intronic
1085460107 11:76688432-76688454 GGCAATGGGACAGCCCGGAAGGG + Intergenic
1088824834 11:113484641-113484663 GCCAATGGGCAAGCCTTGAAGGG - Intergenic
1088908504 11:114172586-114172608 GAGAAATGGGCAGCCTGGAAAGG - Intronic
1089223605 11:116896637-116896659 GCCCAAGGGCCAGCTTGGATGGG - Intronic
1090065797 11:123502399-123502421 GGCAAGGGGTCAGCAGGGAAGGG - Intergenic
1097098705 12:56570865-56570887 GGCAAAGGGACAGCCAGGCGTGG - Intronic
1098969749 12:76839236-76839258 AGCAAAGGGCCAGGGTGAAATGG + Intronic
1100405795 12:94272072-94272094 GGAAGAGGGCCAGGCTGGAAAGG - Intronic
1100545052 12:95593675-95593697 GGATATGGGCCACCCTGGAAAGG + Intergenic
1101400446 12:104382390-104382412 GGCATTGAGCCAGCCTGGAAGGG - Intergenic
1103565524 12:121813380-121813402 GGCAGACGGCCAGGCAGGAAAGG - Intronic
1103586586 12:121960897-121960919 GGCAAAATGCCAACCTGGAGAGG - Intronic
1107418719 13:40225308-40225330 GGCAGAGGTCAAGCATGGAAAGG + Intergenic
1107573304 13:41686878-41686900 TGTGAAGGGGCAGCCTGGAATGG - Intronic
1107732876 13:43365902-43365924 GGCACAGAGACAGGCTGGAAGGG + Intronic
1108244926 13:48504565-48504587 GTAACAGGGCCAGGCTGGAATGG - Intronic
1108699621 13:52932894-52932916 ATCAAAGGGCCTGCTTGGAATGG - Intergenic
1113485667 13:110650705-110650727 TGGAAGGGGCCAGCCTGGCACGG - Intronic
1113912908 13:113852724-113852746 GGCAAAGGTCAAGCATGGCAGGG + Intronic
1114259082 14:21024906-21024928 GGGAAAGGGCCAGCACGGAGCGG - Exonic
1116855836 14:49951592-49951614 GGCATAGGTCCAGGCAGGAAAGG - Intergenic
1117307761 14:54493230-54493252 GGAAAGGAGCCAGCCTGTAAAGG - Intergenic
1117746371 14:58873738-58873760 GGCAAAGGGCCAGCCTTTACAGG - Intergenic
1117853602 14:60003253-60003275 GGCTGAGGGCCAACCTGGGAAGG + Intronic
1118810320 14:69268467-69268489 AGCAAAGGCCTAGCCAGGAAGGG + Intronic
1118982884 14:70730513-70730535 GGCAGCGGCCCTGCCTGGAACGG + Exonic
1119706862 14:76788482-76788504 GGCACAGGGCCAGCTGGGACAGG + Exonic
1119788254 14:77328286-77328308 GGGAAAGGGCCAGAATGGCAGGG + Intronic
1120906039 14:89622218-89622240 AGCAAAGGGCAGGCCTGGAATGG - Intergenic
1122106528 14:99461052-99461074 GGCAGATAGGCAGCCTGGAAGGG - Intronic
1122138985 14:99650860-99650882 GGGAAAGGGCATGCCTGCAAAGG + Intronic
1122897375 14:104766781-104766803 AGCACAAGGCCGGCCTGGAAGGG - Intronic
1123024723 14:105419412-105419434 GGCAAAGGTTAGGCCTGGAAGGG + Intronic
1124341782 15:28894543-28894565 GGCAAAGGGCCAGCCTGGAATGG + Intronic
1127854265 15:62941684-62941706 GGGAATGGGGAAGCCTGGAAGGG + Intergenic
1127922488 15:63504456-63504478 GGGGAGGGGCCGGCCTGGAAAGG + Intergenic
1128399231 15:67260481-67260503 GGGGAAGACCCAGCCTGGAATGG + Intronic
1129385540 15:75194171-75194193 GCCACAAGGCCAGCCTGGGATGG - Intergenic
1129614087 15:77084227-77084249 GGTAAAAGTCCAGCCTGCAATGG + Intergenic
1130882426 15:88066747-88066769 GGAACAGTGCCAGCCTGGGATGG + Intronic
1132656967 16:1045473-1045495 GGCACAGGGCCAGGGTGGAGCGG - Intergenic
1132877824 16:2148266-2148288 GGCAGAGGGCCCGCATGGACGGG - Intronic
1132946284 16:2532888-2532910 GGAACAGGGCCAGTCTGGGAGGG - Intergenic
1134047805 16:11114192-11114214 GGGAAGGGGGCAGCCAGGAATGG - Intronic
1134837689 16:17375854-17375876 GGCAAAGACCCAGACTTGAACGG + Intronic
1135118942 16:19748597-19748619 GGAAAAGAGCCAACCTGTAAAGG + Intronic
1136379945 16:29888560-29888582 GGCACCCGGCCATCCTGGAACGG - Exonic
1136509591 16:30728502-30728524 TGCCAAGGGCCAGACTGGAATGG - Intronic
1139321053 16:66114399-66114421 GGCAAAGGGCCAGACTGGAGTGG + Intergenic
1140849159 16:78918386-78918408 GGTAAGAAGCCAGCCTGGAAAGG - Intronic
1141261733 16:82460370-82460392 GGAAAAGGGCCAGTCTGCAGAGG - Intergenic
1141501297 16:84445913-84445935 AACAAAGGGCCAGGCTGGCAAGG + Intronic
1142104750 16:88296223-88296245 GGGAAGGGGCCAGCCTGGCGGGG + Intergenic
1142125770 16:88409549-88409571 GGCAGGGGGCCAGCCGGGGAGGG + Intergenic
1145233285 17:21190611-21190633 GGCACAGGGCCAGCCCGGGGTGG - Intronic
1146304647 17:31721743-31721765 GGCCAAGAGCCAGCCAGGACTGG + Intergenic
1146666417 17:34707533-34707555 GGCAATGGCACAGCCTTGAAAGG + Intergenic
1146847845 17:36195710-36195732 GCCAGAAGGCCATCCTGGAAAGG - Intronic
1147739967 17:42665849-42665871 GGCCCAGGGCCAGCCTGGCCTGG - Intronic
1148167521 17:45493619-45493641 GGGAGAGGGCCAGAATGGAAGGG + Intergenic
1148235053 17:45963354-45963376 GGTGAAGGGCCAGCATGGGAAGG - Intronic
1148354684 17:46968038-46968060 GGAAGAGGACCAGCCTGGGATGG + Intronic
1148588697 17:48799362-48799384 GGAAAAGGGCCAGCCTGGCAGGG + Intronic
1148953990 17:51338180-51338202 GGAAAAGTGTCAGCCTGGGAGGG + Intergenic
1149522033 17:57324700-57324722 GGGAAAGGTCCAGGATGGAATGG - Intronic
1150398702 17:64840032-64840054 GGGAGAGGGCCAGAATGGAAGGG + Intergenic
1152857652 17:82675335-82675357 GGCAAATGACCAGCTTTGAAAGG + Intronic
1155648989 18:28117357-28117379 GCCAGGTGGCCAGCCTGGAAGGG - Intronic
1157204511 18:45687227-45687249 GGTTAAGGGCTGGCCTGGAATGG + Intergenic
1159011319 18:63061586-63061608 TGAGAAGGGCCAGCCTGGGAAGG - Intergenic
1161190162 19:2950236-2950258 GGCAAAGAGCAAGCTTGTAAAGG - Intergenic
1161353615 19:3806991-3807013 GGGACAGGGCCAGCCTGGCATGG - Intronic
1161393186 19:4031877-4031899 GGCAAAGGGGCAGCTAGGAGGGG - Intronic
1161470695 19:4455611-4455633 GGCAGTGGGCCAGGCTGGGAAGG - Intronic
1163084766 19:14971474-14971496 GGTAAAATGCCAGCCTGCAAGGG - Intronic
1164432205 19:28198312-28198334 GCAGAAGGGCCAGCCTGGAGGGG - Intergenic
1165828920 19:38720862-38720884 GGGAAAATGCCAGCCTGGGAAGG - Intronic
1167430093 19:49449264-49449286 GGAAAAGTGCCAGCCTGGCCAGG + Intronic
1167438131 19:49491632-49491654 GGCAAAGGACCAGCCGGGGTTGG + Intronic
1167960985 19:53103702-53103724 GGCAGAGGGACCGCCAGGAAGGG + Intergenic
1168241614 19:55091756-55091778 GGCCAGGGGCCAGCTGGGAAGGG + Intronic
925079266 2:1049419-1049441 GGGAAAGAGCCAGTCTGTAAAGG - Intronic
926240312 2:11080375-11080397 GCCAAGGGGCCAGGCTGGGAAGG + Intergenic
926332739 2:11838579-11838601 GGACAAGGAGCAGCCTGGAAGGG - Intergenic
926571473 2:14534632-14534654 TGCTAAGGGACAGCCTGGGAGGG + Intergenic
927207404 2:20618964-20618986 GGCCAGGGGCCAGCATGGAAGGG + Exonic
927275475 2:21258786-21258808 GGCAAAGTGCCAGCCAAGCAGGG + Intergenic
927719286 2:25372677-25372699 GGCAAAGGGTGAACCTGAAATGG + Intergenic
927737056 2:25533851-25533873 GGTAAATGGGTAGCCTGGAAAGG - Intronic
929321389 2:40547409-40547431 TGCAAAGGGCAAGTCTTGAAAGG + Intronic
929419506 2:41776407-41776429 GGCCATGGGCAGGCCTGGAATGG + Intergenic
929964573 2:46524647-46524669 GGCAAGGGGCCAGTCAGGGAGGG + Intronic
937036530 2:118786840-118786862 GCCAAAAGGCCAGCCAGGACAGG + Intergenic
937118619 2:119427023-119427045 GGAAAGGAACCAGCCTGGAAAGG + Intergenic
937251764 2:120528365-120528387 GGCAAAAGCCGAGGCTGGAAAGG + Intergenic
937769166 2:125698474-125698496 GGCAAAGTGCCAGCATGGTGGGG + Intergenic
938785807 2:134628348-134628370 GGCCAAGGGCCAGCCTTGAAAGG - Intronic
941869146 2:170365594-170365616 AGCAAAGAGCCAGTCTGAAATGG - Intronic
942235218 2:173897497-173897519 GGCAGAGGCCCAGCCAGGCATGG + Intergenic
944992605 2:205255021-205255043 GGCAAAAGGCAAGGCTGGAAGGG - Intronic
946412368 2:219521766-219521788 GCTGCAGGGCCAGCCTGGAAGGG - Intronic
946804047 2:223452070-223452092 GGCACAGGGGCAGCTTGGAGTGG + Intergenic
947551760 2:231051432-231051454 GCCAAAGGGCCAGGCCTGAATGG + Intergenic
948154376 2:235769508-235769530 GGCAAAGGGCCTGCCCAGGAAGG - Intronic
948826807 2:240577004-240577026 CCCAGGGGGCCAGCCTGGAACGG + Intronic
948969606 2:241414860-241414882 GGCAAAGCACCAGCCTGGGAAGG + Intronic
1168802201 20:650816-650838 GGCACAAGGCCTGCCTGGCACGG - Intronic
1170603114 20:17856765-17856787 GGGAAATGTCCAGCCAGGAATGG - Intergenic
1170827630 20:19810043-19810065 GCCAAAGGGCCACTCAGGAAAGG - Intergenic
1171164329 20:22957171-22957193 GGCAAAGGGGCAGCCTGGAAGGG - Intergenic
1172718850 20:36983997-36984019 GCCAAAGGTCCAGGCTGAAAAGG - Intergenic
1172913918 20:38429812-38429834 GGCAGAGGGCAAGCCCAGAAAGG + Intergenic
1173853080 20:46231185-46231207 GGCCTAGGTCCAGGCTGGAATGG + Intronic
1173995697 20:47337059-47337081 ATCAAAGGGCCAGCCAGGCACGG + Intronic
1174097552 20:48101397-48101419 GGCAAAGGGGCATCAGGGAAAGG - Intergenic
1174163457 20:48568034-48568056 GGCAATGGGCCAGACAGCAAGGG + Intergenic
1174182341 20:48682772-48682794 GGAAAAGGGAGAGCCTGGAATGG + Intronic
1174640652 20:52041057-52041079 GGCTAGGCGCCAGCCTGAAAAGG - Intergenic
1175205180 20:57305713-57305735 GGGAAAGTGCCTGCCTGAAAAGG + Intergenic
1176380235 21:6108960-6108982 GGAAAAGGCCAAGCTTGGAACGG - Intergenic
1177396088 21:20538085-20538107 GGCCATGGTCAAGCCTGGAAAGG + Intergenic
1177486448 21:21762821-21762843 AGCAAAGGGCCAGACTGGGAGGG + Intergenic
1178703947 21:34857683-34857705 GGCAAGGGGCCTGGCTGGGAGGG - Intronic
1178850551 21:36208987-36209009 TGCAAAGGGACATCCAGGAAAGG + Intronic
1179322858 21:40309453-40309475 GGAAAAGGAGCAGCCTGTAAAGG - Intronic
1179743239 21:43429278-43429300 GGAAAAGGCCAAGCTTGGAACGG + Intergenic
1179957744 21:44750606-44750628 GGCAGGGGGCCAGCGTGGAGGGG - Intergenic
1180002915 21:45003150-45003172 GACAAGGAGACAGCCTGGAAGGG - Intergenic
1180255740 21:46626163-46626185 GGCAAAGGGCCTCCCAGGGATGG - Intergenic
1181459287 22:23076790-23076812 GGCACAGGGGCCACCTGGAAAGG - Intronic
1182128760 22:27835303-27835325 TGAAAAGAGGCAGCCTGGAAGGG + Intergenic
1183538705 22:38417534-38417556 GGCAGAGTGGCAGCCTGGACGGG - Intergenic
1183605733 22:38866017-38866039 GGGTAGGGGCCACCCTGGAATGG - Exonic
1183629051 22:39022218-39022240 TGCACAGGGCTGGCCTGGAAAGG + Intronic
1183649131 22:39144373-39144395 GGCAGTGGGACAGCCTGGGAGGG - Intronic
1184115724 22:42421030-42421052 GTCACAGGGCCAGCCTGTAGAGG - Intronic
1184294370 22:43514677-43514699 GGCAAGGGGCGGGCCTGGAAGGG + Intergenic
1185253326 22:49817122-49817144 GGAAAAGGGTCAGCGTGGCAAGG - Intronic
950867977 3:16204650-16204672 GGGAAAGGGACAGTCTTGAAAGG + Intronic
953694247 3:45145754-45145776 GGTAGAGGGCGAGCCTGGAGAGG + Intronic
954652186 3:52171965-52171987 GGAGTAGGGCCAGACTGGAAGGG + Intergenic
954750431 3:52810447-52810469 GGCAGAAGGCCAGGCTGGACTGG + Intergenic
956142834 3:66162947-66162969 AGCAAAGGGTCAGCCTGGATTGG + Intronic
957636482 3:82791514-82791536 TGCAAAGGGCGAGCCAGGCACGG - Intergenic
961385131 3:126518849-126518871 GCAAAAGGGCCAGCGTGGATGGG - Intergenic
961449884 3:126997915-126997937 GGCTCATGGCCAGCCTGGCAGGG + Intronic
961651386 3:128418316-128418338 GGGAAACAGCCAGGCTGGAAAGG - Intergenic
962044139 3:131737716-131737738 AGCAAGGGGCCAGCATAGAAGGG - Intronic
962173483 3:133127660-133127682 GGAAATGAGCCAGCCTGGAGTGG - Intronic
962943775 3:140149131-140149153 GGAGAAGGGACAGCCAGGAATGG - Intronic
966708184 3:182940654-182940676 GGGAAAGGGCCTGCCTGCTATGG + Exonic
967478174 3:189944710-189944732 GGCAAAGGGGGAGGGTGGAAGGG - Intergenic
967826231 3:193879763-193879785 GGCAAGGGGGCAGCGTGGCAAGG + Intergenic
968438938 4:611917-611939 GGCAAAGACACAGCCTGGGAGGG - Intergenic
968951017 4:3691498-3691520 GGCAGCGGGCCAGCCAGGACTGG + Intergenic
969100112 4:4762488-4762510 GGGACAGAGCCAGACTGGAAGGG - Intergenic
974698044 4:65399355-65399377 TGCAAAGGGCAAGCCAGGCATGG - Intronic
975137014 4:70884946-70884968 GTCAAAGGACCAGCCAGGTAAGG - Intergenic
975823589 4:78296370-78296392 GGCAGAGGCCCAGTCTGGGAAGG + Intronic
976280982 4:83326718-83326740 GGAACAGGGCCAGCCTGGAGTGG - Intronic
976708000 4:88039132-88039154 CGCAAAGGCCCACCCTGAAACGG - Intronic
981773652 4:148339173-148339195 GGCAGACGATCAGCCTGGAAGGG + Intronic
981774541 4:148350250-148350272 TCAAAAGGGCCAGCCTGCAAGGG - Intronic
985054173 4:186021655-186021677 GGCCCAGGCCCAGCCTGGGAAGG + Intergenic
986342320 5:6801333-6801355 GGCCAAGGACCAGTCTGGTATGG + Intergenic
988489547 5:31694698-31694720 GGCCAAGGCCCAGCCTGTATAGG - Intronic
991984039 5:72264656-72264678 GGCAAAGGCACAGACTGGAGTGG + Intronic
995435108 5:112127144-112127166 GGCAAAGGGCTAAGCTGGATGGG - Intergenic
996489104 5:124071553-124071575 AGGAAAGGGCTAGGCTGGAAGGG - Intergenic
996826721 5:127691000-127691022 GGCCAAGAGCCAGCAAGGAATGG + Intergenic
997645055 5:135476515-135476537 GGCCAAGGACCAGCCCGGAGGGG + Intergenic
998801609 5:145874789-145874811 GACAGAGGGCAAGGCTGGAAAGG - Intergenic
999303823 5:150507408-150507430 GGAAAAGGGCCAGGCTGGCCAGG - Intronic
999914547 5:156243083-156243105 CACAAAGGGGCAGCCTGGCATGG + Intronic
1000699080 5:164425807-164425829 TGAAAAGGGCCAGTCTGAAAGGG + Intergenic
1001228369 5:169964586-169964608 GAGAAAGGGCCACCCTTGAAGGG + Intronic
1001402019 5:171451336-171451358 GGCAGAGGTCAAGCCTGGACAGG - Intronic
1001487396 5:172129272-172129294 GGCAAGTGGCAAGCCTGGCAGGG - Intronic
1001564201 5:172688985-172689007 CCCAAAGGGGCAGCCAGGAAGGG - Exonic
1001782609 5:174382997-174383019 GTCAAAGGGCAAACCTGTAAGGG + Intergenic
1002212144 5:177605373-177605395 GGCAGAGGGCCTTCCTGGCAGGG - Intronic
1003263500 6:4546508-4546530 GGCAAAGGCCCTGCCTGCCATGG - Intergenic
1003381114 6:5625468-5625490 GGCAAGGGGCCAGCATAGACAGG + Intronic
1004074810 6:12335381-12335403 GGTGAAGGGCCAGTCTGAAAGGG + Intergenic
1004134403 6:12952483-12952505 GGAAAAGAGCCAGCCTGGAAAGG - Intronic
1007584978 6:42984038-42984060 AGCAAAGGGGAAGCCTGGCAGGG - Intergenic
1007754501 6:44090233-44090255 GGCTAAGGGCCACCATGGAGGGG + Intergenic
1012749408 6:103139524-103139546 TGCCAAGGGCAAGCCAGGAATGG + Intergenic
1013077992 6:106788255-106788277 GGTAAAGGGCCAGTATGGAGTGG - Intergenic
1013310329 6:108887929-108887951 AGCAAAGGCCCAACCTGGATGGG + Intronic
1015925770 6:138308904-138308926 GCCACAGAGCCACCCTGGAAAGG - Intronic
1016461702 6:144285523-144285545 GTCAAAGCGCAAACCTGGAAGGG - Intergenic
1018226039 6:161629610-161629632 GGTTCAGGGCCAGCCTGGGAAGG - Intronic
1018378041 6:163232118-163232140 CACAAAGGTCCAGCCTAGAAGGG + Intronic
1019448035 7:1081500-1081522 GGCAAGGGGGCAGCCTGGACTGG + Intronic
1020209821 7:6150281-6150303 GGCAAACGGTCTTCCTGGAAAGG + Exonic
1020405469 7:7828605-7828627 GGCTAAGGGGCTGCCTGTAAAGG + Intronic
1021576923 7:22113348-22113370 TGCAGAGGGCCAGCAGGGAAAGG + Intergenic
1022257877 7:28677462-28677484 GGCCAAGGGTCAGCCTTCAAGGG + Intronic
1022835131 7:34106130-34106152 GGCAAACAGCTAGCCTAGAAAGG + Intronic
1024074903 7:45813342-45813364 GGCAAGGGGTCAGCGTGGGAGGG - Intergenic
1024074924 7:45813424-45813446 GGCAAGGGGTCAGCGTGGGAGGG - Intergenic
1024075024 7:45813816-45813838 GGCAAGGGGTCAGCGTGGGAGGG - Intergenic
1024363530 7:48494473-48494495 GGTAAAGGGGCACCCTGGTAAGG + Intronic
1024747503 7:52425233-52425255 GTCAAGGTGCCAGCATGGAAGGG - Intergenic
1025052469 7:55742186-55742208 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025052790 7:55743460-55743482 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025052801 7:55743493-55743515 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025052812 7:55743526-55743548 GGCAAGGGGTCAGCATGGGAGGG + Intergenic
1025052822 7:55743559-55743581 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025052833 7:55743592-55743614 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025052844 7:55743625-55743647 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025052855 7:55743658-55743680 GGCAAGGGGTCAGCATGGGAGGG + Intergenic
1025052866 7:55743691-55743713 GGCAAGGGGTCAGCATGGGAGGG + Intergenic
1025129468 7:56368015-56368037 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025129561 7:56368367-56368389 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025129593 7:56368498-56368520 GGCAAGGGGTCAGCATGGGAGGG + Intergenic
1028726203 7:94090658-94090680 GGGAAATGGCCTGCCTGAAAGGG - Intergenic
1030134619 7:106234947-106234969 GGAAAGGGGCCAGCCTATAAAGG - Intergenic
1030964737 7:115976966-115976988 GGCAAAGGCACAGCCTCCAAAGG - Intronic
1034437302 7:151069243-151069265 GGTAAAGGGCCGCCGTGGAAGGG + Intronic
1036205811 8:6805201-6805223 GGCAAAGAGTCAGTCTGGAGGGG - Intergenic
1037881065 8:22573709-22573731 GTCAGGGTGCCAGCCTGGAAGGG + Intronic
1038976358 8:32700997-32701019 AGCAAAGGGCCAGCATGGTGTGG - Intronic
1039463049 8:37762277-37762299 GGGAACGGGCAAGCCTGGAAAGG + Intergenic
1039869498 8:41533587-41533609 GCCAAAGGGACAGCCTGACAGGG + Intronic
1046693344 8:117310679-117310701 AGCAAGGGGCCAGAATGGAAGGG + Intergenic
1046976566 8:120285161-120285183 GACAAAGGGCCGGCCAGGCACGG + Intronic
1049056095 8:140238825-140238847 GGAAAACAGCTAGCCTGGAATGG + Intronic
1051798434 9:20903126-20903148 GGGAAAGGGCCTGACTAGAAAGG - Intronic
1052049809 9:23831770-23831792 GGCAGAGGGGGCGCCTGGAATGG + Intergenic
1057177356 9:93010014-93010036 GGCCAAGGGCCAGCCTGCCTGGG + Intronic
1057250051 9:93493790-93493812 GCCAAAGGGCCACTCAGGAAAGG + Intronic
1059100023 9:111461874-111461896 GGCAAAGGGACAGCTTGTACAGG + Intronic
1059656282 9:116360438-116360460 GGCAAAGGAGAGGCCTGGAAAGG + Intronic
1060718446 9:125956522-125956544 GGCCAAGGAGCAGCCTGAAAGGG - Intronic
1061255363 9:129452028-129452050 GGACATGGGCCAGCCTGGGAAGG + Intergenic
1062052435 9:134454541-134454563 GTCACAGAGCCAGCCTGGGATGG - Intergenic
1062184970 9:135213299-135213321 TGCAAGGGGCAGGCCTGGAAAGG - Intergenic
1185696689 X:2200265-2200287 GGAGAAGGACCATCCTGGAAGGG - Intergenic
1190172646 X:48123792-48123814 GGCACAGGTCCATCCTGGTATGG + Intergenic
1190179636 X:48181169-48181191 GGCACAGGTCCATCCTGGCATGG + Intergenic
1190190561 X:48273600-48273622 GGCACAGGTCCATCCTGGCATGG - Intronic
1190198496 X:48340450-48340472 GGCACAGGTCCATCCTGGCATGG + Intergenic
1190665259 X:52690863-52690885 GGCACAGGTCCATCCTGGCATGG + Intronic
1190674163 X:52767556-52767578 GGCACAGGTCCATCCTGGCATGG - Intronic
1191171685 X:57453900-57453922 TCCACAGGGCCAGCCTGGCAAGG + Intronic
1196866124 X:120072746-120072768 GGCAGTGGGCCAGCCTGTCATGG - Exonic
1196872204 X:120123426-120123448 GGCAAGGCACCAGGCTGGAAGGG + Intergenic
1196876972 X:120163535-120163557 GGCAGTGGGCCAGCCTGTCATGG + Exonic
1197533495 X:127661497-127661519 GGCTAGTTGCCAGCCTGGAAAGG + Intergenic
1197885874 X:131217851-131217873 ACCAAAGGGCCAGGCTGGGAAGG - Intergenic
1199657983 X:150016814-150016836 TGCAAAGGGCCTGTTTGGAATGG + Intergenic
1201148494 Y:11080956-11080978 GGCACAGGGTCTGCCTGTAATGG + Intergenic