ID: 1124342099

View in Genome Browser
Species Human (GRCh38)
Location 15:28896147-28896169
Sequence TTTGATGCGGGGGTTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 782
Summary {0: 1, 1: 0, 2: 8, 3: 81, 4: 692}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124342087_1124342099 21 Left 1124342087 15:28896103-28896125 CCTGTCTCAAAAAAAATATCTGA 0: 1
1: 4
2: 52
3: 610
4: 5081
Right 1124342099 15:28896147-28896169 TTTGATGCGGGGGTTGGGGGTGG 0: 1
1: 0
2: 8
3: 81
4: 692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124342099 Original CRISPR TTTGATGCGGGGGTTGGGGG TGG Intronic