ID: 1124343461

View in Genome Browser
Species Human (GRCh38)
Location 15:28904842-28904864
Sequence TCCCACTGCCTCGTGTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124343461_1124343467 12 Left 1124343461 15:28904842-28904864 CCATGACACACGAGGCAGTGGGA 0: 1
1: 0
2: 3
3: 11
4: 101
Right 1124343467 15:28904877-28904899 AGAGACTGTTAGTTATTCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 167
1124343461_1124343466 11 Left 1124343461 15:28904842-28904864 CCATGACACACGAGGCAGTGGGA 0: 1
1: 0
2: 3
3: 11
4: 101
Right 1124343466 15:28904876-28904898 GAGAGACTGTTAGTTATTCCAGG 0: 3
1: 0
2: 2
3: 6
4: 117
1124343461_1124343468 19 Left 1124343461 15:28904842-28904864 CCATGACACACGAGGCAGTGGGA 0: 1
1: 0
2: 3
3: 11
4: 101
Right 1124343468 15:28904884-28904906 GTTAGTTATTCCAGGGAGAGAGG 0: 1
1: 2
2: 0
3: 13
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124343461 Original CRISPR TCCCACTGCCTCGTGTGTCA TGG (reversed) Intronic
901957618 1:12797843-12797865 TCCCACTGCCTGGTCTCTCATGG + Intergenic
901965622 1:12863597-12863619 TCTCACTGCCTCATCTCTCATGG + Intronic
901981019 1:13033975-13033997 TCTCACTGCCTCATCTCTCATGG + Intronic
902001068 1:13194955-13194977 TCTCACTGCCTCATCTCTCATGG - Intergenic
902020299 1:13340659-13340681 TCTCACTGCCTCATCTCTCATGG - Intergenic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
907524678 1:55047169-55047191 TCCCTCTGCCTGGTGTGGCCTGG + Intronic
909465017 1:75963868-75963890 TCCCACTCCCTGGTGTGCAAAGG + Intergenic
911557032 1:99356918-99356940 TCCCAATGTGTGGTGTGTCATGG - Intergenic
921368141 1:214394330-214394352 TCCAACTGCCTTATGTGTGATGG - Intronic
922594385 1:226802814-226802836 TCCCCCTGCCCCGTGAGTGAGGG + Intergenic
923285410 1:232490089-232490111 CCCCACTGCCTCCTGAATCAAGG + Intronic
1065571384 10:27073579-27073601 TCCCCCTGCCACATTTGTCAAGG + Intronic
1066124638 10:32328714-32328736 CCCCACAGCCCCGTGTGACAAGG - Intronic
1068963900 10:62892820-62892842 TCCCCTTGCCTTGTGTGTCAAGG + Intronic
1071358039 10:84818042-84818064 TCCCACTGCCACTGGTGTGATGG - Intergenic
1071880890 10:89897343-89897365 TCCCCCAGCCTCCTCTGTCAAGG - Intergenic
1071950343 10:90696856-90696878 TCCCACTGCCTCTTTGGTAATGG + Intergenic
1075612059 10:123862256-123862278 TGCCACTGCCTCGTGTGCCACGG + Intronic
1076726719 10:132417283-132417305 CCCGACTGCCTCGTGAGCCAGGG - Exonic
1081911110 11:46700567-46700589 TCCCTCTGCCACGCCTGTCAAGG + Exonic
1085597240 11:77820982-77821004 TGCCACTGCCTCGTGTGACAGGG + Exonic
1092125102 12:6069554-6069576 CCCCACTGCCTGCTGAGTCATGG + Intronic
1096493837 12:52027692-52027714 TCCCCATGCCTCCTGTTTCACGG + Intronic
1098534034 12:71574718-71574740 AAACACTGGCTCGTGTGTCAGGG - Intronic
1099128181 12:78792832-78792854 TTCCACTGCCCCATGTGTCATGG - Intergenic
1101068569 12:101048940-101048962 TCACACAGCCTAGTGTGTAAAGG - Intronic
1102944426 12:116973508-116973530 TCTCACTGCATCGTGTCACATGG - Intronic
1102963667 12:117110595-117110617 TATCACTGCTTCGTGGGTCAGGG - Intergenic
1103597983 12:122035704-122035726 TCTCTCAGCCTCGTGTGTCCAGG + Intronic
1104715483 12:131013400-131013422 TCCCAGGGCCTCGTGCCTCAGGG + Intronic
1107431060 13:40340737-40340759 ACCCACTCCCTCCTGTGACAAGG + Intergenic
1113797532 13:113067019-113067041 AGCCTCTGCCTCGTGGGTCACGG - Intronic
1121272138 14:92644883-92644905 GCACAATGCCTGGTGTGTCAGGG - Intronic
1124343461 15:28904842-28904864 TCCCACTGCCTCGTGTGTCATGG - Intronic
1124965130 15:34427908-34427930 TCCCACTGCCCGATGTGTCATGG + Intronic
1124981742 15:34574118-34574140 TCCCACTGCCCGGTGTGTCATGG + Intronic
1128504474 15:68256922-68256944 TCCCACCGCGTCGTGGGGCAGGG + Intronic
1129039237 15:72671196-72671218 TTCCAGTCCCTCGTATGTCAGGG - Intergenic
1131963108 15:97809721-97809743 TCCCCCTGCCTCATGAGTTAGGG - Intergenic
1132066809 15:98737962-98737984 TCCCACTGCCTTGTGTATGAAGG + Intronic
1132414682 15:101611942-101611964 GCCCCCTGCCTTGCGTGTCACGG - Intergenic
1132996876 16:2828034-2828056 TCCCACTGACTAGTGTTTCAAGG - Intergenic
1135298151 16:21301228-21301250 TCTCTCTCCCTCGTGTGCCATGG - Intronic
1136060905 16:27725817-27725839 TCCCACTTCCTGGTGTGACCAGG - Intronic
1138144373 16:54595567-54595589 TCTCACTGCCTCTGCTGTCAGGG - Intergenic
1141919304 16:87125451-87125473 TCTCACTGCCCCGTGTGGCCCGG + Intronic
1142106481 16:88306338-88306360 TGCCTCTGCCTCCTGTGTGAGGG + Intergenic
1144735720 17:17554239-17554261 TCCCACTGCCTTGTGGCTGAGGG - Intronic
1145314465 17:21721143-21721165 TTCCACTGCCAGGTGTGCCAGGG - Intergenic
1145712920 17:26993120-26993142 TTCCACTGCCAGGTGTGCCAGGG - Intergenic
1148844009 17:50518092-50518114 TCCCACTGCTTCCTGGGCCACGG + Intronic
1152309568 17:79541588-79541610 TCACATGGGCTCGTGTGTCAAGG - Intergenic
1156310262 18:35915819-35915841 CCCCACTTCCTCGGGTCTCAAGG + Intergenic
1157842640 18:50973464-50973486 TCCCAAGTCCTCGTGAGTCATGG + Intronic
1158380680 18:56926839-56926861 ACCCTCTGCCGAGTGTGTCACGG - Intronic
1160167496 18:76527295-76527317 TCCCACTGACTCCTCTCTCAAGG - Intergenic
928958470 2:36896645-36896667 TCCCACGTCCCCTTGTGTCATGG - Intronic
938952462 2:136267491-136267513 ACCCATTGCCTTGTGTGTCAGGG + Intergenic
941923747 2:170875760-170875782 TCCCACTGGCTGGTGTGGCAAGG - Intergenic
945674668 2:212841603-212841625 TCTCAGTGCATCTTGTGTCACGG + Intergenic
947136546 2:226981879-226981901 TCTCACTGCCACGTATCTCATGG + Intronic
947367207 2:229408944-229408966 TCCCACTGCCTCGTGCCTGGTGG + Intronic
947496873 2:230644041-230644063 TCCCACTGCCTCTTGTCCCCAGG - Intergenic
948385032 2:237575819-237575841 TCCCTCTGCCTCATGTTTCCTGG - Intronic
948423781 2:237875787-237875809 GCCCAATGGCTGGTGTGTCAGGG - Intronic
1169131138 20:3166938-3166960 TGCCACTGCCTCGGGGGCCAGGG + Exonic
1171445076 20:25196961-25196983 TCCCACCGCCTCCTGTGTAAAGG + Intronic
1172793961 20:37524452-37524474 TCCCACTCCCCAGTGAGTCAGGG + Intronic
1175682001 20:60995765-60995787 CCCCTCTGCCCCGTTTGTCATGG - Intergenic
1179172169 21:38981181-38981203 TCCCCCTGCCTTGTGTGCCTTGG - Intergenic
1180010953 21:45050964-45050986 GCACAGTGCCTCGCGTGTCACGG - Intergenic
1180067370 21:45419130-45419152 ACACACGGCATCGTGTGTCAGGG - Intronic
1181043854 22:20205425-20205447 CCCCACTGCCTCCTGTGTGCTGG + Intergenic
1182512687 22:30830323-30830345 TCACACTGGGTGGTGTGTCAAGG + Intronic
1183181867 22:36265655-36265677 TCCCAATGCCTCGTGTGAGTTGG - Exonic
950010272 3:9718089-9718111 TCCCACTGCCTTGAGGGCCATGG - Exonic
953926736 3:46986375-46986397 CCCCACTGCCTTGTGTGACTTGG - Intronic
954779938 3:53051480-53051502 TCCCACTGCCTCTTGGGGAAAGG - Intronic
957231221 3:77518194-77518216 TCCCACTTGCTCCTGTGACAAGG - Intronic
961158315 3:124700050-124700072 TCCCACTGCCTGGGGGGCCAGGG - Intronic
963631817 3:147742283-147742305 TTTCACTGCCTTCTGTGTCAGGG - Intergenic
967251146 3:187540391-187540413 TCAAACTGGCTCTTGTGTCACGG - Intergenic
976837187 4:89388121-89388143 TCCCACTGGCTTCCGTGTCAGGG - Intergenic
985540508 5:485328-485350 TCCAACGGCCTCGGGTGCCATGG - Intronic
985662718 5:1165339-1165361 GCCCAGTGCCTCCTGTCTCAAGG - Intergenic
985852207 5:2397175-2397197 TCCCACTGCCTCCTCTCCCAGGG + Intergenic
992068783 5:73130534-73130556 GCCCACTGCCTGCTCTGTCAAGG - Intronic
995596593 5:113754025-113754047 TCCCACTACTTTGTATGTCAGGG + Intergenic
997612075 5:135222357-135222379 TCTCAGTGCCTTGTGTGTCAAGG + Intronic
1002388699 5:178892076-178892098 TCCCACTGCCTAGCGTGGCAAGG + Intergenic
1002414046 5:179109218-179109240 ACCCTCTGCCTCCTGGGTCAAGG - Intergenic
1015544925 6:134352101-134352123 TCCCACTGCCTGCTGAATCAAGG + Intergenic
1016981629 6:149860236-149860258 GCCCCTTGCCTTGTGTGTCAGGG - Intronic
1020125044 7:5528908-5528930 TAACACTGGCTCGTGTGACAAGG - Intronic
1021433741 7:20590752-20590774 GTCCACTGCCTCATGTGTCCTGG + Intergenic
1022280416 7:28903063-28903085 TCCCACTGCTCAGTGTGTGAGGG + Intergenic
1022468747 7:30668812-30668834 TCCCCCTGCCAAGTGAGTCAGGG + Intronic
1022602309 7:31772933-31772955 TCCCTCTGGCTTGTGTGCCATGG - Intronic
1023076231 7:36485502-36485524 TCCCACTAGCCAGTGTGTCAAGG - Intergenic
1026563531 7:71470449-71470471 TCCCAGTGCTTCCTGTGTAAAGG + Intronic
1028522928 7:91752448-91752470 TCCCACTGCCTCCTTTGGCTGGG - Intronic
1030678350 7:112408198-112408220 TTCCACTGGCTCGTTTCTCAGGG + Intergenic
1034822733 7:154232013-154232035 TCAAACAGCCTCGTGTTTCATGG + Intronic
1035122058 7:156576965-156576987 GACCACTGCCTGGTGTGTGATGG + Intergenic
1036709098 8:11066953-11066975 TCCCACTGCATCGTGCGAGATGG + Intronic
1037561628 8:20080226-20080248 TCCCACTGCCTCCTGTTACTAGG + Intergenic
1039072540 8:33659930-33659952 TCCCACTGCTTCCTGTCACATGG - Intergenic
1047025391 8:120817985-120818007 TCCCACTGCCTTCTCTGGCAAGG + Intergenic
1048493225 8:134913699-134913721 TCCCACTGCAGAGGGTGTCATGG + Intergenic
1055748661 9:79479410-79479432 TGCCTCTGCCTTGTGTGTAAGGG + Intergenic
1060557466 9:124515998-124516020 GCCCACCGCCTCGTGAGTCCAGG - Intergenic
1060604891 9:124904860-124904882 TCTCTCTGCCTCCTGTGTCCTGG - Intronic
1061497527 9:130983483-130983505 GCCCACTGCCTCATGGGACATGG - Intergenic
1189941343 X:46125534-46125556 TTCCATTGCCTCATGTGACAGGG + Intergenic
1190436656 X:50432224-50432246 TCCCACTGCTTCCTGTGCTAAGG + Intronic