ID: 1124343780

View in Genome Browser
Species Human (GRCh38)
Location 15:28907714-28907736
Sequence AATCTGTGGGGACTCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124343773_1124343780 -2 Left 1124343773 15:28907693-28907715 CCCATCATAGATATGACTCCGAA 0: 1
1: 0
2: 2
3: 5
4: 47
Right 1124343780 15:28907714-28907736 AATCTGTGGGGACTCTCCCTGGG 0: 1
1: 0
2: 2
3: 13
4: 100
1124343774_1124343780 -3 Left 1124343774 15:28907694-28907716 CCATCATAGATATGACTCCGAAT 0: 1
1: 0
2: 2
3: 5
4: 122
Right 1124343780 15:28907714-28907736 AATCTGTGGGGACTCTCCCTGGG 0: 1
1: 0
2: 2
3: 13
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124343780 Original CRISPR AATCTGTGGGGACTCTCCCT GGG Intronic
901866530 1:12110219-12110241 AAGCTGTGGGTCGTCTCCCTGGG + Intronic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
909365446 1:74815208-74815230 AATCTGTGATAACTCTCACTGGG + Intergenic
909970730 1:81984637-81984659 GAACTGTGGGGACTCTCAGTTGG - Exonic
910112968 1:83701735-83701757 GGTCTGTGGGGACTCAGCCTGGG - Intergenic
914343098 1:146776773-146776795 ACTCTGTGGGGACGGTCCCGGGG - Intergenic
914680509 1:149935448-149935470 AATCAGTGGGAACTCTCTCTAGG - Intronic
916403252 1:164471444-164471466 AATCAGTGGAGTCTCTCACTGGG - Intergenic
916749226 1:167709273-167709295 AAGCTGTGGGGCTTCTCCATGGG + Intergenic
919328171 1:196135785-196135807 GAGCTGTGGGGCCACTCCCTTGG + Intergenic
922513352 1:226187291-226187313 AATTTGTGGGGACCCTCATTAGG + Intergenic
1067456730 10:46424581-46424603 GTTGTGTGGGGTCTCTCCCTGGG + Intergenic
1067630472 10:47960058-47960080 GTTGTGTGGGGTCTCTCCCTGGG - Intergenic
1067789703 10:49278414-49278436 ACTCTGTGGGGTCTGTCCCTTGG + Intergenic
1067804853 10:49385402-49385424 TATCTCTGGGCACTCTCCCATGG + Intronic
1068096785 10:52500740-52500762 AATTTGTGAGGGCTCTTCCTTGG - Intergenic
1070765607 10:79054472-79054494 AGTCTGTGGGGAGACTGCCTGGG - Intergenic
1071399563 10:85256284-85256306 ACTCTAGGGTGACTCTCCCTCGG + Intergenic
1073481127 10:103786810-103786832 AGGCTGGGGGGACTCTCCGTAGG - Intronic
1075760177 10:124849550-124849572 ACTCTGTGCCCACTCTCCCTGGG - Intergenic
1078421923 11:11219538-11219560 AAACTGGGGGGACGCTCACTGGG - Intergenic
1079417268 11:20250921-20250943 AATCTCTGGCTACTGTCCCTAGG + Intergenic
1082183242 11:49145640-49145662 AATGTGAGGGGACTCTTCATTGG + Intergenic
1086404706 11:86489691-86489713 GAGCTGGGGAGACTCTCCCTGGG + Intronic
1086610136 11:88745701-88745723 AATCTGTGAGGTCTCACACTGGG - Intronic
1086683119 11:89699692-89699714 AATGTGAGGGGACTCTTCATTGG - Intergenic
1095666298 12:44803143-44803165 ATTCTGTAGGGCCTCACCCTGGG - Intronic
1096694511 12:53339918-53339940 ATTCTCTGGTGATTCTCCCTAGG - Intronic
1099503943 12:83449047-83449069 TATATGTGGGCACTTTCCCTAGG + Intergenic
1102778581 12:115543076-115543098 AATCTTTGAGGACTCTGGCTGGG - Intergenic
1109368358 13:61388379-61388401 AATCTGTGCAAACTCTTCCTAGG - Intergenic
1111101308 13:83591502-83591524 AATCTCTGGGTACTGTACCTTGG + Intergenic
1111387050 13:87540654-87540676 AATCTGAGTGGCCTCTCCCTGGG + Intergenic
1112204106 13:97306929-97306951 AATGTGTGGAGGCTCTGCCTTGG + Intronic
1113546980 13:111160553-111160575 AATCTCCTGGGTCTCTCCCTAGG - Intronic
1113764818 13:112874649-112874671 AATCCGGAGGGACTCTTCCTGGG - Intronic
1114921995 14:27343549-27343571 AATCAGTGGGGACTCTGTGTGGG - Intergenic
1115444980 14:33479651-33479673 ACTCTGTGGGCACTTTTCCTCGG + Intronic
1119539641 14:75429389-75429411 AATCTTGGTGGTCTCTCCCTAGG + Intronic
1124343780 15:28907714-28907736 AATCTGTGGGGACTCTCCCTGGG + Intronic
1124964142 15:34420810-34420832 AATCTGTGGGTACTCTCCCCAGG - Intronic
1124980755 15:34567038-34567060 AATCTGTGGGTACTCTCCCCAGG - Intronic
1125698870 15:41661923-41661945 GATCTGTCGGGACTCTTCCCCGG + Intronic
1129218951 15:74120169-74120191 AATCTTAGGTGACTCTCACTAGG + Intronic
1129703976 15:77784107-77784129 AATCTGTCAGGACCCTCCTTTGG + Intronic
1129881649 15:79010721-79010743 AAGGTGGGGGCACTCTCCCTGGG - Intronic
1131136323 15:89938991-89939013 AATTTTTGAGGACTCTCCATGGG - Intergenic
1131825189 15:96315733-96315755 AATCTTTGAGTGCTCTCCCTGGG - Intergenic
1135036728 16:19084800-19084822 AATCTGTGGAGACGCTCACATGG + Intergenic
1138112993 16:54339444-54339466 ATTCTTTTGGGTCTCTCCCTAGG + Intergenic
1139049046 16:63100264-63100286 GATCTGTGGGTACTCAGCCTAGG + Intergenic
1139356706 16:66371197-66371219 ACTCTGTGGGGACTCTCAAATGG - Intronic
1139526136 16:67518070-67518092 GCTCTGTGGGGTCCCTCCCTTGG - Intergenic
1139902151 16:70336451-70336473 AATCTTTTGGGAGTCTCCCCAGG - Intronic
1139990893 16:70938555-70938577 ACTCTGTGGGGACGGTCCCGGGG + Intronic
1147453730 17:40521604-40521626 GATACGTGGGGACTCTCCCTGGG - Intergenic
1148829913 17:50425002-50425024 GAAGTGTGGGGACCCTCCCTAGG + Intergenic
1150269599 17:63855082-63855104 TATCAGAGAGGACTCTCCCTAGG + Intergenic
1151392490 17:73797141-73797163 AGTCTGTAGAGACTCTCACTGGG - Intergenic
1154109183 18:11551332-11551354 TATCTCTGGGAACTCTTCCTAGG + Intergenic
1154350537 18:13579661-13579683 AATCTTTGGTGACTTTGCCTGGG - Intronic
1158095376 18:53764165-53764187 TATGTGTGAGGACTCACCCTAGG - Intergenic
1168713780 19:58515827-58515849 AAGCTGTGGGGAGGTTCCCTCGG - Intronic
929080383 2:38116536-38116558 TATTTGTGAGGACTTTCCCTAGG + Intergenic
929451816 2:42043035-42043057 ATTTTTTGGGGACTCTGCCTTGG + Intergenic
929704276 2:44194333-44194355 AATCTGTGGGTACTTTCTCTGGG + Intronic
934778398 2:96953508-96953530 CAACTGTGGGGTCTCTCCCTTGG - Intronic
934855440 2:97726435-97726457 AATCTGTGGGGACAATTCTTGGG + Intronic
937314603 2:120922971-120922993 ACTCTGTGGGAACCCTCCCCAGG + Intronic
946319221 2:218940157-218940179 AAGCTTCAGGGACTCTCCCTCGG - Intergenic
947301439 2:228691915-228691937 AATCTCTGTGGACTCTTTCTAGG + Intergenic
1169789372 20:9393188-9393210 GATCTGGGGGGCCTCTCACTTGG + Intronic
1172586913 20:36092042-36092064 ACTCTCTGGGGACTCTCCAAGGG - Intronic
1176944496 21:14962520-14962542 AATATGTTGGTATTCTCCCTTGG - Exonic
1181414185 22:22747487-22747509 AATCTGTGGGGACTGAGCCTGGG - Intronic
1182422299 22:30254424-30254446 ACTCTGTGGGGACCCCCCCTGGG - Intergenic
1184370131 22:44076814-44076836 AGCCTGTGGGCACTCTCCCTAGG - Intronic
955231879 3:57106788-57106810 ATTATATGGAGACTCTCCCTGGG - Intronic
961018946 3:123487959-123487981 AATCTGCTGGGCCTCACCCTGGG - Intergenic
964376021 3:156049953-156049975 TATCTGTGGCCACTCTCCCATGG + Intronic
969535170 4:7752188-7752210 AAACTGTGAGGAGTCTTCCTTGG + Intergenic
969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG + Intronic
971791920 4:31180998-31181020 AATCTGTGTGGACTCCCAGTTGG + Intergenic
975574385 4:75848305-75848327 ATTCTATGGGGACTCTTCCTTGG + Intergenic
978369388 4:108015473-108015495 ATTCTGAGGGGTCCCTCCCTGGG + Intronic
980613985 4:135194635-135194657 CTTCTGTGGGGACTCTGCATAGG - Intergenic
981311742 4:143304321-143304343 TATCTGAGGGAAGTCTCCCTGGG - Intergenic
989362739 5:40622426-40622448 GACCTGTGGGGACTCTCCTTAGG + Intergenic
992947790 5:81826376-81826398 ACTCTGTGGAGACTCTCTTTGGG + Intergenic
996051349 5:118937698-118937720 GGTCTGTGGGGATTATCCCTTGG - Intronic
996101376 5:119449083-119449105 AACCTGTGTGGACTAACCCTAGG + Intergenic
1000665271 5:163987325-163987347 AATATATGGTGACTCTCTCTTGG - Intergenic
1000998000 5:167978262-167978284 AAGCTTTGGGGGATCTCCCTAGG - Intronic
1003183755 6:3813248-3813270 ACTCTGGGGGGCCTCTCCCTTGG - Intergenic
1003723166 6:8728826-8728848 AATCTCTGGGGACTAACCCTTGG - Intergenic
1004078745 6:12370063-12370085 GATCTGTGGGGAAGCCCCCTGGG - Intergenic
1007765382 6:44156802-44156824 AGACTTTGGGGACTCTACCTGGG - Intergenic
1018705465 6:166460718-166460740 ACACCGTGGGGACCCTCCCTAGG - Intronic
1018814918 6:167323392-167323414 AATCTGTGTGGTCAGTCCCTAGG + Intergenic
1021551448 7:21875461-21875483 AAACTGTGGACACTCTCCCCAGG + Intronic
1027387322 7:77671505-77671527 CATCTTTGGGGCCTCTTCCTTGG - Intergenic
1033195876 7:139326858-139326880 AAACTGTGGTGACTGTGCCTGGG + Intergenic
1041530523 8:58860667-58860689 TATCTATGGGGACCTTCCCTGGG + Intronic
1053186281 9:36019272-36019294 GATCTGTAGGGACTCTGTCTGGG - Intergenic
1056724693 9:89104510-89104532 ATTCTGTGGGCACTCTGACTTGG - Intronic
1061419647 9:130466345-130466367 CAGCTCTGTGGACTCTCCCTGGG + Intronic
1061593468 9:131613750-131613772 GATCTGTGGAGACTCAACCTTGG + Intronic
1062108623 9:134769652-134769674 AATCTGTGGGGACAGTGGCTGGG + Intronic
1185499871 X:588589-588611 AATCTGTGAGAACTTTCCTTAGG + Intergenic
1194733223 X:97480502-97480524 ATTCTTTGGGGACTTTTCCTAGG - Intronic
1195925404 X:110019681-110019703 AATCTACTTGGACTCTCCCTGGG - Intronic
1196812969 X:119643206-119643228 AAGCTGTGGGGTCTCTCCAGGGG - Intronic
1197528886 X:127598455-127598477 AATCTGTCTGGATTCTCCTTTGG - Intergenic
1197664329 X:129207313-129207335 ATTCTGTGGTGAATCTGCCTGGG + Intergenic
1197719680 X:129736709-129736731 ATTATGTGGGGACCATCCCTGGG + Intergenic
1198344033 X:135741760-135741782 TATCTGTGGGTTCTCTCTCTCGG + Intergenic