ID: 1124345303

View in Genome Browser
Species Human (GRCh38)
Location 15:28918215-28918237
Sequence CAGAAGCGTTCCTGGCGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124345295_1124345303 18 Left 1124345295 15:28918174-28918196 CCTGCGGTCTCCGTGGGTGAGGG 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1124345303 15:28918215-28918237 CAGAAGCGTTCCTGGCGCCACGG 0: 1
1: 0
2: 1
3: 7
4: 83
1124345298_1124345303 8 Left 1124345298 15:28918184-28918206 CCGTGGGTGAGGGAAAAGGCACA 0: 1
1: 0
2: 2
3: 37
4: 252
Right 1124345303 15:28918215-28918237 CAGAAGCGTTCCTGGCGCCACGG 0: 1
1: 0
2: 1
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124345303 Original CRISPR CAGAAGCGTTCCTGGCGCCA CGG Intronic
900330083 1:2129796-2129818 CAGAAGCCTCCCTGTGGCCAAGG - Intronic
900363419 1:2300784-2300806 CAGGAGCGTCCCTGGCCCCAAGG + Intronic
900622962 1:3595848-3595870 CAGAAGCCATTCTGGCTCCAGGG - Intronic
902599230 1:17529800-17529822 CTGATGTGTTCCTGGCCCCATGG - Intergenic
903205986 1:21782960-21782982 GGGAGGCGTTCCTGGGGCCAAGG - Exonic
903508389 1:23854508-23854530 CAGAACTGTTCCTGTCACCATGG - Exonic
905409981 1:37761897-37761919 CAGCAGCATCCCTGGCGCCGCGG - Exonic
908781151 1:67691704-67691726 CCTAAGTGTTCCTGGGGCCAGGG + Intergenic
910163477 1:84298762-84298784 CAGAAGCGTGCCCTGCCCCACGG + Intronic
915471843 1:156130359-156130381 CAGGAACGTGCCTGGGGCCAAGG - Intronic
916742023 1:167654507-167654529 CAGAGGCATTCCTGTAGCCAGGG + Intronic
919909353 1:202101298-202101320 CAGGAGTGTTGCTGGGGCCAAGG - Intergenic
1063251426 10:4279362-4279384 CAGCAGGTGTCCTGGCGCCATGG - Intergenic
1065020457 10:21497475-21497497 CAGAGGCGTCCCTGGCGCCTTGG - Intergenic
1076547270 10:131253819-131253841 AAGAATTGTTCCTGGCACCAGGG + Intronic
1078335802 11:10462399-10462421 CAGTAGTGTTTCTGGAGCCAAGG + Intronic
1079370682 11:19849490-19849512 CAGAGAGGTACCTGGCGCCAGGG - Intronic
1084021703 11:66421632-66421654 CAGAAGCGCTCCGGGAGCCGGGG + Intronic
1085723490 11:78933646-78933668 CAGAAGCGTTCAGGAGGCCAAGG + Intronic
1089691007 11:120186671-120186693 CAGAGGAGTTCCTGGCAGCAGGG + Intergenic
1094327991 12:29260716-29260738 CAGATGCCTTCCTGGAGCCAGGG - Intronic
1095971572 12:47905233-47905255 CAGAAGCGTGCCTTGCCCTATGG - Intronic
1096072569 12:48783340-48783362 CAGAAGCGTTCGCGGCGCCGTGG - Exonic
1097375841 12:58841389-58841411 CACTGGCGTTCCAGGCGCCATGG + Intergenic
1100331970 12:93591563-93591585 GGGAAGTGATCCTGGCGCCACGG + Intergenic
1102300714 12:111769004-111769026 CAGAAGGGTTCCTAGGGCGATGG - Intronic
1107107820 13:36665521-36665543 CAGAACAGTTCCTGGCACAAGGG + Intergenic
1114737438 14:25057054-25057076 CAGAAGCTTTCCAGGCCCCATGG + Intergenic
1124345303 15:28918215-28918237 CAGAAGCGTTCCTGGCGCCACGG + Intronic
1128535906 15:68490102-68490124 CAGAAGGGTTCCTTGAGCCCAGG - Intergenic
1141419561 16:83904263-83904285 CAGAAGCCCTCCTGGCCCCTGGG + Intronic
1141958822 16:87391602-87391624 CAGGAGAGTTCCAGGCGCCGCGG + Intronic
1142123855 16:88400545-88400567 CAAAGGCCTTCCTGGGGCCAGGG + Intergenic
1145794410 17:27647182-27647204 CAGTAGCCTTCCTGAAGCCAGGG - Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1150684386 17:67308886-67308908 CAGAAGGGTTGCTTGAGCCAAGG + Intergenic
1161065991 19:2237658-2237680 CAGAAGCGTTCTCGGCTACAAGG - Exonic
1161477018 19:4491783-4491805 AAGCAGCGGTCCGGGCGCCACGG + Exonic
1162324795 19:9992835-9992857 CAGAGGCTCTCCTGGCCCCACGG - Exonic
1162382349 19:10339047-10339069 CAGAAGGGTTCCTGCCTTCATGG + Intronic
1162503900 19:11071003-11071025 CTGAAGCGATCCTCCCGCCATGG - Intergenic
1167000925 19:46745677-46745699 CAGAAGCTTGCCGGGCGCCGAGG - Intronic
926088680 2:10036213-10036235 CAGGGGCTTTCCTGGCACCAGGG - Intergenic
929830737 2:45344407-45344429 CAGCAGCATGCCTGGGGCCACGG - Intergenic
931658292 2:64530504-64530526 CAGAAGGGTTCCTGCCATCATGG - Intronic
934900025 2:98152316-98152338 CAGAAGCTTTCATGGAGGCATGG + Intronic
941962087 2:171263522-171263544 CAGCTGCCTCCCTGGCGCCAGGG + Intergenic
943015963 2:182511390-182511412 CAGAGGAGCTCCTGGGGCCAGGG + Intronic
1169069490 20:2714577-2714599 CAGAAGAATTCCTGGAGCCCAGG - Intronic
1176219603 20:63963730-63963752 GAGAAGCCTGCCTGGGGCCAGGG + Intronic
1179181919 21:39053066-39053088 GAGAAGCATTTCTGGCGCCGTGG - Intergenic
1182318880 22:29465714-29465736 CCGAGGCCTTCCTGGCCCCAAGG + Intergenic
1183455769 22:37922308-37922330 CAGAGGCCTTCCTGGGGGCAGGG - Exonic
1184552582 22:45212416-45212438 CAGTGGCGTTCCTGGCTCCTCGG - Exonic
950746465 3:15093936-15093958 CTGAAGCGATCCTCCCGCCATGG + Intronic
954600968 3:51868985-51869007 CAGAAGCATTCCTGGAACCAGGG - Intergenic
958896319 3:99833685-99833707 CAGGAGCGGTCCTGACTCCAGGG + Intronic
960592015 3:119375942-119375964 CAGAAGGGTTGCTGGAGCCGTGG - Intronic
961537222 3:127577510-127577532 CAGAAGCCTGCCTGGCACCCAGG + Intronic
961621089 3:128225694-128225716 CAGAAGAGGTCTTGGGGCCAGGG - Intronic
966373325 3:179271073-179271095 CAGCAACATTCCTGGCGCAAAGG - Intergenic
966885584 3:184376309-184376331 CTGAATCCTTCCTGGGGCCATGG + Exonic
970193155 4:13533773-13533795 CAGAATTTTTCCTGGCGCCTAGG - Intergenic
976589090 4:86831350-86831372 CAGAAGCATTCCTGGGGTCACGG - Intronic
978845594 4:113269294-113269316 CACTGGCGTTCCAGGCGCCACGG + Intronic
985471705 5:50825-50847 CAGAGGCGGTCCTGGCGCCAGGG - Intergenic
985675077 5:1226762-1226784 CAGAGGCGTCCCTGGCTCCCGGG + Intronic
985706042 5:1401905-1401927 CATCAGCTTTCCTGGGGCCATGG + Intronic
985754051 5:1702617-1702639 CAGAAGTGTTTCTGGCCCAAGGG + Intergenic
993664840 5:90683301-90683323 CAGAAGGGTCCCTGGAGCCCAGG - Intronic
1001301979 5:170540215-170540237 CAGGAGCTTTCCTGGGGGCATGG + Intronic
1004253804 6:14044361-14044383 CAGAAGCTTCCTTGGCCCCAGGG - Intergenic
1005701796 6:28408896-28408918 CAGAAGCTTTTCTGCCGTCATGG + Intergenic
1008841054 6:55904778-55904800 CAGAAATGTTCATGGGGCCAAGG + Intergenic
1016959858 6:149662871-149662893 CAGAAGGATTCCTGGAGCCCAGG + Intronic
1020874302 7:13674040-13674062 CACTGGCGTTCCAGGCGCCATGG + Intergenic
1023045415 7:36206080-36206102 CAGAAGCTTTCCTGGTTCAAAGG + Intronic
1023253960 7:38294472-38294494 CAGTAGCCTTCCTGGCTCCTTGG + Intergenic
1026207466 7:68270688-68270710 CAGAAGGATTCCTTGAGCCAAGG + Intergenic
1040080115 8:43276254-43276276 CAGAAGCGTCACTGGCTCCTGGG + Intergenic
1049265570 8:141666151-141666173 CAGAAGTGAACCAGGCGCCAAGG - Intergenic
1049693271 8:143972007-143972029 CTGAGGCTTTCCTGGCCCCAGGG - Intronic
1059824817 9:118017208-118017230 CAGAAACTTGCCTGGAGCCAAGG + Intergenic
1060381847 9:123182782-123182804 CAGCAGGGTTCCTTGAGCCAAGG + Intronic
1060991995 9:127854615-127854637 CAGCAGCAGTCCTGGCCCCAGGG + Exonic
1061841983 9:133364100-133364122 AGGAAGAGCTCCTGGCGCCATGG - Intronic
1062003146 9:134226795-134226817 CAGAAGCGTTCCTGGGTCGTGGG - Intergenic
1187169210 X:16834937-16834959 CACAAGCGATCCTGCCGCCTCGG - Intronic
1187859479 X:23667523-23667545 CAGAAGCGGCGCTCGCGCCAAGG + Exonic
1189991134 X:46596285-46596307 CAGAGGCATTCCTGGAACCAGGG - Intronic
1195287204 X:103396756-103396778 CAGCAGCCTTCCTGGCTCCCAGG - Intergenic
1200081327 X:153578247-153578269 CTGAAGCATTTCTGGGGCCAAGG - Intronic