ID: 1124345546

View in Genome Browser
Species Human (GRCh38)
Location 15:28919334-28919356
Sequence CCCCGCCCGCGGTTGTTGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124345542_1124345546 -10 Left 1124345542 15:28919321-28919343 CCAGGAGCCTGAGCCCCGCCCGC 0: 1
1: 1
2: 4
3: 59
4: 450
Right 1124345546 15:28919334-28919356 CCCCGCCCGCGGTTGTTGAACGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124345546 Original CRISPR CCCCGCCCGCGGTTGTTGAA CGG Intronic
1067369833 10:45672841-45672863 CCCCGCCCGCGCTGATTGGAGGG - Intergenic
1073305685 10:102502051-102502073 GCCCGCCCGCGGGTGGAGAACGG - Intronic
1077326420 11:1965914-1965936 CCCTGCCCGCGGGTGTAGGAGGG + Intronic
1077375836 11:2204753-2204775 CCCCGCCCAGGGTTGTGGAGAGG - Intergenic
1084665832 11:70575781-70575803 CCCCGCCCGTGGTGGGTGATGGG + Intronic
1088691641 11:112333418-112333440 CCCTGCCCTGGGTTGTTGTAAGG + Intergenic
1202809401 11_KI270721v1_random:21093-21115 CCCTGCCCGCGGGTGTAGGAGGG + Intergenic
1106010484 13:25816433-25816455 CCCCGCACCCAGTTGCTGAATGG + Intronic
1121536529 14:94694913-94694935 CCCAGCCCTAGGTTGTTGCAGGG - Intergenic
1124345546 15:28919334-28919356 CCCCGCCCGCGGTTGTTGAACGG + Intronic
1132894677 16:2223207-2223229 CCCCGCCCGCGGCTGCTGCTGGG - Intergenic
1133997820 16:10761774-10761796 CCGCGCCCCCGGTTGTGGGAGGG - Exonic
1148196427 17:45716528-45716550 ACCCGCCAGCGGATGTTGGAGGG + Intergenic
1160947944 19:1652208-1652230 CCCCGCGCGCGCTTGTTGGGGGG - Intronic
1161388110 19:4007685-4007707 CCCCGCCCGCGAGTGGTGAGCGG + Exonic
1167721299 19:51182201-51182223 CACCGCCCGCGGCTGCTGATTGG - Intergenic
926155029 2:10448692-10448714 CCCGGCCCGCGGCAGCTGAACGG + Intergenic
929571806 2:43027374-43027396 CCCCGCCCGCTGAAGATGAAAGG + Intergenic
935144885 2:100388882-100388904 CCCCGCCCACTGTAGTAGAAGGG + Intergenic
938790232 2:134669878-134669900 TCCAGCCCCCGGTTGTTCAAGGG + Intronic
954649654 3:52153471-52153493 CTCCTCCCTCTGTTGTTGAAAGG - Intronic
959197202 3:103199758-103199780 CCATGCCAGTGGTTGTTGAATGG - Intergenic
971160809 4:24132100-24132122 ACCCTCACGGGGTTGTTGAAAGG - Intergenic
974842706 4:67316628-67316650 TCACTCCCGTGGTTGTTGAAGGG - Intergenic
979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG + Exonic
1003566902 6:7229832-7229854 CTCCGCCCGCGGCTGCTGCAGGG - Exonic
1015960200 6:138640780-138640802 CCCCACCCCCAGTTGTTCAAGGG + Intronic
1018787153 6:167116982-167117004 CCCCTCCCGCGGTGGGTGGAGGG + Intergenic
1021171100 7:17398928-17398950 CCCCCACCGCTGTTGTTCAAGGG - Intergenic
1021405996 7:20267777-20267799 CTCCCCCCGCGGTGGTTGAAGGG + Intergenic
1042916191 8:73878400-73878422 CTGCGCCCGCGGTTGTTGCCGGG - Intronic