ID: 1124347950

View in Genome Browser
Species Human (GRCh38)
Location 15:28934858-28934880
Sequence CTTCCCACCTGCTCTCCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 361}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124347950_1124347956 -1 Left 1124347950 15:28934858-28934880 CCGTCAGGAGAGCAGGTGGGAAG 0: 1
1: 0
2: 4
3: 44
4: 361
Right 1124347956 15:28934880-28934902 GGGAGGCAGGTCCCTGAACTGGG 0: 1
1: 1
2: 2
3: 16
4: 241
1124347950_1124347958 10 Left 1124347950 15:28934858-28934880 CCGTCAGGAGAGCAGGTGGGAAG 0: 1
1: 0
2: 4
3: 44
4: 361
Right 1124347958 15:28934891-28934913 CCCTGAACTGGGATAGAGCCCGG 0: 1
1: 0
2: 1
3: 21
4: 195
1124347950_1124347960 18 Left 1124347950 15:28934858-28934880 CCGTCAGGAGAGCAGGTGGGAAG 0: 1
1: 0
2: 4
3: 44
4: 361
Right 1124347960 15:28934899-28934921 TGGGATAGAGCCCGGAGACCTGG 0: 1
1: 0
2: 0
3: 15
4: 126
1124347950_1124347955 -2 Left 1124347950 15:28934858-28934880 CCGTCAGGAGAGCAGGTGGGAAG 0: 1
1: 0
2: 4
3: 44
4: 361
Right 1124347955 15:28934879-28934901 AGGGAGGCAGGTCCCTGAACTGG 0: 1
1: 0
2: 2
3: 27
4: 225
1124347950_1124347961 19 Left 1124347950 15:28934858-28934880 CCGTCAGGAGAGCAGGTGGGAAG 0: 1
1: 0
2: 4
3: 44
4: 361
Right 1124347961 15:28934900-28934922 GGGATAGAGCCCGGAGACCTGGG 0: 1
1: 0
2: 0
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124347950 Original CRISPR CTTCCCACCTGCTCTCCTGA CGG (reversed) Intronic