ID: 1124347961

View in Genome Browser
Species Human (GRCh38)
Location 15:28934900-28934922
Sequence GGGATAGAGCCCGGAGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124347948_1124347961 21 Left 1124347948 15:28934856-28934878 CCCCGTCAGGAGAGCAGGTGGGA 0: 1
1: 0
2: 0
3: 8
4: 191
Right 1124347961 15:28934900-28934922 GGGATAGAGCCCGGAGACCTGGG 0: 1
1: 0
2: 0
3: 15
4: 167
1124347949_1124347961 20 Left 1124347949 15:28934857-28934879 CCCGTCAGGAGAGCAGGTGGGAA 0: 1
1: 0
2: 0
3: 29
4: 260
Right 1124347961 15:28934900-28934922 GGGATAGAGCCCGGAGACCTGGG 0: 1
1: 0
2: 0
3: 15
4: 167
1124347950_1124347961 19 Left 1124347950 15:28934858-28934880 CCGTCAGGAGAGCAGGTGGGAAG 0: 1
1: 0
2: 4
3: 44
4: 361
Right 1124347961 15:28934900-28934922 GGGATAGAGCCCGGAGACCTGGG 0: 1
1: 0
2: 0
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124347961 Original CRISPR GGGATAGAGCCCGGAGACCT GGG Intronic