ID: 1124349916

View in Genome Browser
Species Human (GRCh38)
Location 15:28947650-28947672
Sequence TCTGGTTCCCAGGAGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124349916_1124349925 20 Left 1124349916 15:28947650-28947672 CCCACAGCCTCCTGGGAACCAGA 0: 1
1: 0
2: 4
3: 40
4: 323
Right 1124349925 15:28947693-28947715 CAGAACTAAGCCTTAAAATCAGG 0: 1
1: 0
2: 1
3: 14
4: 212
1124349916_1124349921 -9 Left 1124349916 15:28947650-28947672 CCCACAGCCTCCTGGGAACCAGA 0: 1
1: 0
2: 4
3: 40
4: 323
Right 1124349921 15:28947664-28947686 GGAACCAGAGCTCCTTGCCTGGG 0: 1
1: 1
2: 5
3: 23
4: 180
1124349916_1124349920 -10 Left 1124349916 15:28947650-28947672 CCCACAGCCTCCTGGGAACCAGA 0: 1
1: 0
2: 4
3: 40
4: 323
Right 1124349920 15:28947663-28947685 GGGAACCAGAGCTCCTTGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 208
1124349916_1124349926 23 Left 1124349916 15:28947650-28947672 CCCACAGCCTCCTGGGAACCAGA 0: 1
1: 0
2: 4
3: 40
4: 323
Right 1124349926 15:28947696-28947718 AACTAAGCCTTAAAATCAGGAGG 0: 1
1: 0
2: 2
3: 16
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124349916 Original CRISPR TCTGGTTCCCAGGAGGCTGT GGG (reversed) Intronic
900180990 1:1310880-1310902 TCTGGGTCACAGGTGGCTCTGGG + Intronic
901987361 1:13086568-13086590 TCTGGTTCCTGGGGGACTGTTGG - Intergenic
901994451 1:13140199-13140221 TCTGGTTCCTGGGGGACTGTTGG + Intergenic
902116476 1:14125603-14125625 TATGGTTCCCTGGAGACTTTTGG + Intergenic
902171489 1:14615223-14615245 TCTGGTTTCCAGCAGGTGGTCGG - Intronic
902833054 1:19029953-19029975 CCTGGCTCCCAGGTGACTGTGGG + Intergenic
903884057 1:26530910-26530932 TCTCCTTCCCAGGTGGTTGTTGG + Intronic
904303531 1:29571791-29571813 TCTGCTTCATAGGATGCTGTGGG + Intergenic
904428282 1:30445808-30445830 TCCGCTTCCCAGGATGATGTGGG - Intergenic
904563192 1:31412418-31412440 TGTAGCTCCCAGCAGGCTGTTGG + Intronic
905485492 1:38292898-38292920 TCTGGTTGCCAAGAGGATGAAGG - Intergenic
905583377 1:39098938-39098960 GCTGGTGCCCAAGAGGCTGGTGG + Intronic
905629778 1:39512073-39512095 TCTGCTTCCCAGGAAGCAGGCGG + Intronic
905667981 1:39774117-39774139 TCTGCTTCCCAGGAAGCAGGCGG - Intronic
906075573 1:43049536-43049558 TCTGGCTCACGGGAAGCTGTGGG + Intergenic
906521799 1:46471194-46471216 TCAGGTTCTAAGGATGCTGTAGG + Intergenic
907553059 1:55320321-55320343 TTTGCTTCCCAGGAGGCTTTTGG - Intergenic
907818347 1:57942095-57942117 TCTGGCTCCCAGGATGCTCTGGG + Intronic
910773297 1:90851232-90851254 TCTGGTTCCCACGTTGCAGTTGG - Intergenic
911477356 1:98389963-98389985 TCTGGTTCCCATCAGGCTCCTGG - Intergenic
911530218 1:99035555-99035577 GATGGTTGCCAGGAGGCTGGGGG + Intergenic
912511544 1:110193470-110193492 CCTGGTTCCCAAGATGCTGTGGG - Intronic
912911137 1:113759811-113759833 TCTGTTCCCCAGTGGGCTGTGGG + Intergenic
915276020 1:154788702-154788724 GCTGGCTCACAGGAGGCTGTGGG - Intronic
916444924 1:164863389-164863411 CCTGGTTCACAGTAGGCTCTCGG - Intronic
919198610 1:194321337-194321359 TCTGGAACCCAGGAGGCGGGAGG + Intergenic
920209890 1:204320422-204320444 TCAGCTCCCCAGGAGACTGTGGG + Intronic
920652599 1:207850158-207850180 TCTGGCTCCCAGGGGACAGTTGG - Intergenic
921356441 1:214288522-214288544 TGTGGTTCCCTGGAGACTGGGGG + Intronic
921839507 1:219813325-219813347 TCTGGTTCCCACATGCCTGTAGG - Intronic
923361572 1:233217040-233217062 GGTGGTTACCAGGAGGCAGTGGG + Intronic
924377544 1:243429362-243429384 TCTGGTCAACAGTAGGCTGTTGG + Intronic
1064479174 10:15722026-15722048 TCAGGTACTCAGGAGGCTGAGGG + Intergenic
1065149946 10:22812474-22812496 TCTGGAACCCAGGAGGCTGATGG + Intergenic
1067546903 10:47198402-47198424 TCTTGTTCTCAGGCGCCTGTAGG - Intergenic
1068952846 10:62794497-62794519 CCTTGATCCCAGGAGGCAGTGGG + Intergenic
1069091210 10:64200925-64200947 TCTGGGCTCCAGGAGGCTGATGG + Intergenic
1071336989 10:84608381-84608403 TCTGGGTTACAGGAGGATGTAGG + Intergenic
1073453482 10:103622931-103622953 GCTGATTCCCAGGAGGGTGTGGG + Intronic
1075541806 10:123319812-123319834 TCTGCATCTCATGAGGCTGTTGG - Intergenic
1075545434 10:123351404-123351426 TCTCATCTCCAGGAGGCTGTGGG + Intergenic
1075836005 10:125453369-125453391 CCAGGACCCCAGGAGGCTGTGGG - Intergenic
1076048325 10:127312760-127312782 TCTGGCTGCCAGGAGGATGGGGG - Intronic
1076905836 10:133360532-133360554 TCTGGTTCCCTGAACGCTGCAGG - Intergenic
1077112244 11:866945-866967 CCTGTTTTCCAGGAGGCTGGGGG - Exonic
1077135997 11:999025-999047 TCTGGTGCACAGGCTGCTGTGGG + Intronic
1077239344 11:1502488-1502510 TCAGGTGCCCAGGAGCCAGTAGG - Intergenic
1077302202 11:1852551-1852573 TGTGGGTCCCAGGTGGCTTTGGG - Intergenic
1078007115 11:7540381-7540403 TCTGGTGCCCAGTTGGATGTGGG + Intronic
1078765131 11:14289134-14289156 TCTTTTTCCTAGGAGGCTGTAGG + Intronic
1080711829 11:34755816-34755838 TATGCTTCCCAGAAGGCTGTGGG + Intergenic
1081037972 11:38173937-38173959 TATGGTGCCCAGGCAGCTGTAGG + Intergenic
1081596880 11:44465605-44465627 TCTGTTTCCCAGGAGGCAGCAGG + Intergenic
1081813528 11:45926420-45926442 CCTGGGACCCAGGAGGGTGTTGG - Exonic
1082646452 11:55732653-55732675 TCTTGTTCCTTGAAGGCTGTTGG - Intergenic
1082798185 11:57393843-57393865 TCTGGCACCCAGGATGTTGTAGG - Intronic
1082998016 11:59268158-59268180 AGTGGTTCTCAGGTGGCTGTGGG - Intergenic
1083939313 11:65887043-65887065 GCTGCTACCCAGGAGGCAGTGGG + Intronic
1084312088 11:68322932-68322954 TCTGGGCCCTAGGAGGCTGGTGG - Intronic
1084468808 11:69343167-69343189 TCTGGTCCCCAGGGAGCTGAGGG - Intronic
1084916816 11:72434645-72434667 TACGTTTCCCAGAAGGCTGTGGG + Exonic
1085518691 11:77125920-77125942 TCTGGTCCCCAGGAGACCTTGGG + Exonic
1087093168 11:94296233-94296255 TCAATTTTCCAGGAGGCTGTGGG - Intergenic
1089395124 11:118131711-118131733 TCAGCTTTCCAGGAGGCTGGGGG - Intergenic
1090837017 11:130461324-130461346 TCTTCTTCCTAGGAGGTTGTGGG - Intronic
1090879056 11:130817199-130817221 GCTGATTCCCAGCAGGCTGATGG + Intergenic
1091204760 11:133812557-133812579 TCTTCTTCCCAGGAGCCAGTTGG - Intergenic
1092776123 12:11946483-11946505 TCTGTTTTCCAGGAGGATGGTGG - Intergenic
1093686772 12:22065189-22065211 TCTACTGCCCAGAAGGCTGTTGG + Exonic
1096513695 12:52145313-52145335 TCTGCTTCCCAGGAAGCTGCTGG - Intergenic
1096598903 12:52715543-52715565 TCTGGTTCCCAGGAGGCCAGAGG - Intergenic
1098640269 12:72830546-72830568 TCTGGCTCCTAGGATGCTGATGG + Intergenic
1098985329 12:77005874-77005896 ACTGTTTGCCAGCAGGCTGTTGG - Intergenic
1099139430 12:78953041-78953063 TCTGCTTCCAAGGAGCCTATGGG - Intronic
1100437419 12:94584360-94584382 TCTGGTTCTGGGGAGGCTGCGGG - Intronic
1102223263 12:111209280-111209302 CCAGCTACCCAGGAGGCTGTGGG + Intronic
1103412815 12:120724916-120724938 GGTGGTGCCCAGGAGGCTATGGG + Intergenic
1104019050 12:124979760-124979782 TCTGGTGGCAAGGAGGGTGTGGG - Intronic
1104935238 12:132360900-132360922 ACTGGTTCCTCGGAGGCTGTCGG - Intergenic
1105213324 13:18270722-18270744 TCAGGTTCCTTGGAGGCTGAGGG + Intergenic
1106195441 13:27490391-27490413 TCTGGAGCCCAGGAGGCTTGTGG - Intergenic
1106358723 13:29010359-29010381 TTTGGTTCCAAGGAGGCTGGAGG - Intronic
1108430119 13:50344927-50344949 GCTGGTGCCCAGGCGTCTGTGGG - Intronic
1108466977 13:50726367-50726389 GCTGGTTCCCAGGGGGATTTGGG - Intronic
1110717016 13:78717211-78717233 TTTGGTTACCAGGAGGAAGTAGG - Intergenic
1111166196 13:84460958-84460980 TCTGGTCCACTGGAGCCTGTAGG - Intergenic
1113928031 13:113952050-113952072 TCTGGTTCCTTGGGGGCTGTCGG - Intergenic
1114159174 14:20143963-20143985 TGTGGTTCCCAGGATGTTGGTGG + Exonic
1114181687 14:20373370-20373392 GCTGTGTCCCAGGAGGGTGTGGG + Exonic
1114619287 14:24085426-24085448 TCTAGTTCCCAGATGGCTGAGGG + Intronic
1114684044 14:24511023-24511045 GCTGCTTCCCAAGATGCTGTAGG - Intergenic
1116290285 14:43026463-43026485 TCTGCTTCTGAGGAGGCTGCAGG - Intergenic
1116805555 14:49490952-49490974 TCTGGTGCCCAGGAGATTTTGGG + Intergenic
1117450374 14:55844373-55844395 CCTGGGTCTCAGGAGGATGTCGG - Intergenic
1118380914 14:65216924-65216946 CCTGGGTTCCAGGAGGTTGTGGG - Intergenic
1120243302 14:81975137-81975159 TCAGGATCTCAGGAGGCTGGTGG + Intergenic
1121794507 14:96724048-96724070 TCTGTATCCCAAGAGACTGTGGG + Intergenic
1122251597 14:100443984-100444006 TCTGGCTGACAGGTGGCTGTTGG - Intronic
1122299799 14:100725190-100725212 GCTGGCTCCAAGGAGGCTGGAGG - Intergenic
1122795278 14:104203002-104203024 CTTTGTGCCCAGGAGGCTGTAGG + Intergenic
1124349916 15:28947650-28947672 TCTGGTTCCCAGGAGGCTGTGGG - Intronic
1124810673 15:32935034-32935056 TCAGGTACTCAGGAGGCTGAGGG - Intronic
1124902214 15:33834994-33835016 CCTGGCTCACAGCAGGCTGTGGG + Exonic
1125253399 15:37732899-37732921 TCTGGTTCCCAGGATGCAGTGGG + Intergenic
1125760912 15:42094796-42094818 GCTGGTTCCCCTGAGGCTGAGGG + Intergenic
1126110889 15:45174093-45174115 TGTGGGTGCCAGGAGGCTATGGG - Intronic
1126226428 15:46275812-46275834 TCAGGTTCTCTGGAGGCTTTGGG + Intergenic
1126257498 15:46644949-46644971 TCTGGTTCCCAGGAGGTGCCAGG - Intergenic
1126750577 15:51872752-51872774 TCTGGTCCTCAGGTGGGTGTGGG - Intronic
1128545637 15:68565905-68565927 TCTGCTTCCCTGCTGGCTGTGGG - Intergenic
1128799471 15:70488455-70488477 TCTGCCTCCCAGGTGGCTGTGGG - Intergenic
1129591699 15:76920816-76920838 TCTGGTTATCAGGAGGAGGTAGG - Intergenic
1129720280 15:77874249-77874271 GCTGGCTCTCGGGAGGCTGTGGG - Intergenic
1129845994 15:78767971-78767993 TCTGGGTCCCTGGAGGCCCTGGG - Intronic
1130599080 15:85264094-85264116 TCTGGGTCCCCGGAGGCCCTGGG - Intergenic
1131426328 15:92348128-92348150 TCTGGTGTCCAGAATGCTGTGGG - Intergenic
1132749751 16:1452089-1452111 GCTGGAGCCCAGGAGGCTCTGGG - Intronic
1133224005 16:4332001-4332023 TCTGCTTCCCATGAGTCTCTTGG - Intronic
1133307274 16:4818407-4818429 TCAGCTACCCAGGAGGCTGAGGG - Intronic
1134855223 16:17513074-17513096 TGTGGTTTGCAGGTGGCTGTCGG + Intergenic
1135040185 16:19112462-19112484 CCTGGTTCCCAGGTGGCAGCTGG + Intergenic
1135204938 16:20475603-20475625 TTTGGTTCCAGGGAGGCTGAGGG + Intronic
1135213956 16:20548210-20548232 TTTGGTTCCAGGGAGGCTGAGGG - Intronic
1136387086 16:29935029-29935051 TCTGGTTCACAGTAGGCTATTGG - Intergenic
1137675942 16:50303976-50303998 TCTGGTTCCAAGGAGCCTCAAGG + Intronic
1138380885 16:56601549-56601571 CCTTCTCCCCAGGAGGCTGTGGG - Intergenic
1138566054 16:57833580-57833602 TCTGGGTCCTGGGAGTCTGTGGG - Intronic
1139331091 16:66190762-66190784 TCTGGGTCCTAGGATGCTGGTGG - Intergenic
1139336104 16:66232397-66232419 CATGGTACCCAGGAGGCTGTTGG - Intergenic
1139404902 16:66710531-66710553 TCTGCTACTCAGGAGGCTGACGG - Intergenic
1139519560 16:67473025-67473047 GCTGGTTCCTGGAAGGCTGTGGG - Intronic
1140332931 16:74075177-74075199 ACTGGTTCTCAGGAAGCTATTGG + Intergenic
1140469059 16:75204660-75204682 ACTGGGCCCCAGGAGGGTGTGGG + Intronic
1140772589 16:78218464-78218486 TGAGGATGCCAGGAGGCTGTTGG + Intronic
1140928051 16:79601207-79601229 TCTGGTACCCAGGTGTCTGCCGG + Intergenic
1141110328 16:81266313-81266335 TGTGGTTCCCAGGAGGGTCCTGG - Intronic
1141237121 16:82229010-82229032 TCTGGTCCTCAGGAGGGTGAAGG + Intergenic
1141425788 16:83943595-83943617 ACTGGTCCCAAGGAGGGTGTAGG + Intronic
1141434248 16:83990346-83990368 ACTGGACCCCAGGAGGCCGTGGG + Intronic
1141840613 16:86571931-86571953 TCTGGTCCTCAGGAGGTTCTGGG + Intergenic
1142201669 16:88763999-88764021 TTTGGCCCCCAGGAGGCTGTGGG - Intronic
1143124290 17:4631769-4631791 TCTCCCTCCCAGGTGGCTGTGGG - Exonic
1143633164 17:8150254-8150276 GCTGGCACTCAGGAGGCTGTAGG + Exonic
1143921938 17:10336998-10337020 GCTTGTACCCAGGAGGCGGTGGG - Intronic
1144955667 17:19017705-19017727 CAGGGTTTCCAGGAGGCTGTGGG - Intronic
1146106137 17:30039133-30039155 TGTGGTTCTCAGGATGGTGTTGG - Intronic
1146632568 17:34481446-34481468 TATGGTTCCCAGAAGCCTGATGG + Intergenic
1148635782 17:49148421-49148443 TCTTGTTGGCAGCAGGCTGTGGG + Intronic
1148677101 17:49451871-49451893 TCTGGTTTACTTGAGGCTGTGGG - Intronic
1150121471 17:62606877-62606899 AGTGTTTCCCAGTAGGCTGTGGG + Intronic
1151406277 17:73888925-73888947 TTTCGTTCCCAGCTGGCTGTAGG - Intergenic
1151454602 17:74218339-74218361 TAGGGTTCCCAGGAGGGTTTGGG + Intronic
1152601866 17:81266694-81266716 TCTGTTTCCCAGGTGGCTGTTGG - Intronic
1152632884 17:81418450-81418472 TCTGGTTCCCATGCAGCAGTGGG + Intronic
1153502450 18:5762942-5762964 TCTGGTGCCAAGTGGGCTGTGGG - Intergenic
1153782705 18:8508493-8508515 TGTCGTTCCCAGCAGGCTGCAGG + Intergenic
1156216251 18:35001007-35001029 ACTGGATCCCAGGAGGTTGAGGG + Intronic
1156652894 18:39247687-39247709 AATGGTTGCCAGGAGGATGTGGG + Intergenic
1157493548 18:48139727-48139749 TCCTGTTCCCAGGAGGCAGCTGG - Intronic
1157539633 18:48491073-48491095 TCTGCCTTCCAGGAGGCTCTTGG - Intergenic
1157758330 18:50238757-50238779 TCTGGTGCCCAGAAAGATGTTGG - Intronic
1158694766 18:59694257-59694279 TCTCTTTACCAGGTGGCTGTTGG - Intronic
1159498876 18:69242674-69242696 TCTGGTCCCAAGGTTGCTGTGGG - Intergenic
1160515517 18:79477459-79477481 TCTGGTCCCCAGGTGGCATTGGG - Intronic
1160749628 19:727745-727767 GCTGGCTCCCGGGAGGGTGTGGG + Intronic
1161008566 19:1948793-1948815 TCTGGTCACCAGCAGGCTGTCGG - Intronic
1161527114 19:4763162-4763184 CCTGGTTCCCTGGAGGATGAGGG + Intergenic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162547834 19:11341454-11341476 TTTTGTTCCCACGAGGCAGTGGG - Intronic
1164034281 19:21439354-21439376 TCTGGTTCCCAGGGGGCTGCTGG + Intronic
1164697361 19:30255896-30255918 GCAGTTTCCAAGGAGGCTGTTGG - Intronic
1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG + Intergenic
1165610483 19:37147096-37147118 TCTGGTTCTCATGAGGCTGATGG + Intronic
1166381949 19:42359255-42359277 TGTGGCTCCCAGGAGGCTGAGGG + Intronic
1166836127 19:45669107-45669129 CCGGGTTCCCAGGAGTCTGTAGG + Intronic
1167149919 19:47702479-47702501 TCGAGTCCCCAGGAGGCTGAGGG - Exonic
1167497996 19:49830504-49830526 TCAGGTTCCCGGGAACCTGTGGG - Exonic
924973521 2:153282-153304 TGTGGTTCACAGGTAGCTGTAGG + Intergenic
925387617 2:3473141-3473163 CCTGGTTCCCAGCAGGCCCTCGG + Intronic
927206635 2:20615304-20615326 GCTGCTTCACAGGATGCTGTGGG + Intronic
928390172 2:30903550-30903572 TTTGGTTCCTCGCAGGCTGTTGG - Intergenic
930851558 2:55966547-55966569 TCTGTCTCCCAGGAGACTGAGGG + Intergenic
931513750 2:63028515-63028537 TCAGGTACTCAGGAGGCTGAGGG - Intronic
932437815 2:71713119-71713141 CCTGGTTCCCAGGAACCTGGAGG + Intergenic
932688220 2:73891500-73891522 TGTGGTGCCCAGGTGGTTGTGGG + Intergenic
932763968 2:74458573-74458595 TGTGGTCCTCAGGGGGCTGTAGG + Exonic
933763620 2:85692737-85692759 TTTGGGGCCCAGGAGGCTGAGGG - Intronic
933817089 2:86076941-86076963 TATGGTTCCCAAGAGGCAGTGGG + Intronic
933909972 2:86930762-86930784 TGTGGTCCTCAGGGGGCTGTAGG - Intronic
934022753 2:87972626-87972648 TGTGGTCCTCAGGGGGCTGTAGG + Intergenic
934300999 2:91776022-91776044 TCAGGTTCCTTGGAGGCTGAGGG - Intergenic
934313534 2:91893966-91893988 CCAGGTTCTCAGGAGGCTGAGGG + Intergenic
935336971 2:102025066-102025088 TCTGTTTCTCAGGGAGCTGTGGG + Intronic
935940102 2:108229110-108229132 GCTTCTTCCCAGGAGGCTGATGG + Intergenic
936039710 2:109140982-109141004 TCTGGTTGTCAGGATGCTTTAGG - Intronic
936513452 2:113167080-113167102 TCTGGTGCCAAGGGGGCTGGGGG + Intronic
936958560 2:118048706-118048728 TCTGATTGACAGGATGCTGTGGG + Intergenic
937434172 2:121866682-121866704 TCTGCTTCCCAGCAGCCTCTTGG - Intergenic
940761894 2:157747934-157747956 ACTGGTTCCCAGAATGTTGTGGG - Intronic
940789632 2:158018572-158018594 GCTGTTTCCCAGGTGGCAGTGGG + Intronic
941836144 2:170022850-170022872 TCTGGTTCCCAAGAGACAGAAGG - Intronic
943744640 2:191448887-191448909 TCAGCTTCTCAGGAGGCTGAGGG - Intergenic
944254183 2:197608181-197608203 TGTGATGCCCATGAGGCTGTTGG + Intronic
944858617 2:203792497-203792519 TTTGGTTCCCAGGAGGCTGAAGG + Intergenic
944966133 2:204936080-204936102 TCTGTTTCCCAGTGTGCTGTAGG + Intronic
946027400 2:216680082-216680104 TCTGGTTCCTCTGAGGCTGGGGG - Intronic
947127998 2:226891950-226891972 TCTGGCTGCCAGGAAGCTGAGGG + Intronic
947230852 2:227884877-227884899 TCTGGGCCCCAGCAGGCAGTTGG - Intronic
947461198 2:230306235-230306257 GCAGGTTCCCAGGATGCAGTGGG - Intronic
948151938 2:235751393-235751415 TCTGGTGCCCAGGGGGTTGTCGG + Intronic
948555099 2:238804150-238804172 TCTCTGGCCCAGGAGGCTGTGGG - Intergenic
948572527 2:238926762-238926784 CCTGGCTCCTAGGAGGCTCTGGG - Intergenic
948595308 2:239075964-239075986 TCTGTTTCCCAGGAAGCTGAGGG - Intronic
948638729 2:239359731-239359753 GCTTCCTCCCAGGAGGCTGTGGG - Intronic
948687165 2:239676631-239676653 TCTTTGTCCCTGGAGGCTGTGGG + Intergenic
948897740 2:240935099-240935121 CCTGTTTCCCAGGTGGCTGTGGG + Intronic
1169106305 20:2998140-2998162 TCTGGTAGCCAGGAGGCTGGAGG - Intronic
1169405425 20:5317421-5317443 ACTGGTGCCCAGGAAGCTCTGGG + Intergenic
1170935450 20:20805446-20805468 GCTGGCTCCCTGGAGGGTGTTGG + Intergenic
1171179854 20:23084505-23084527 TCTGGCCCCCAGGAGCCTGCAGG - Exonic
1172190888 20:33061223-33061245 AGTGGTTCCCAGGATGGTGTTGG + Intronic
1172505441 20:35458300-35458322 CCAGGTTCACAGGTGGCTGTTGG + Exonic
1172620349 20:36314243-36314265 TCTGGTTCACAGGGGACTCTGGG + Intronic
1173674214 20:44820079-44820101 TCTCATTCCCAGGAGACTGGCGG - Intergenic
1174390516 20:50216064-50216086 TCTGTTTCCCAGGAGGCTCCTGG + Intergenic
1175250961 20:57610031-57610053 TCTGGTTTCCCGGAGTCTGGAGG - Intronic
1175337163 20:58204150-58204172 GCTGGTTCCTCGGAGGCTCTAGG - Intergenic
1176094934 20:63336313-63336335 TCTTGTTTCCAGGAGTCTGTGGG - Intergenic
1176150399 20:63587951-63587973 TGTGGTTCCCATGAGGATGAGGG + Exonic
1177941543 21:27417741-27417763 TCTGTTGCCCAGGGGGCTCTGGG - Intergenic
1180248324 21:46563124-46563146 TCTGTTTCCCCAGATGCTGTTGG - Intronic
1181037060 22:20174777-20174799 CCTGTTTCCCAGGGAGCTGTTGG + Intergenic
1181674316 22:24441857-24441879 TGTGGGTGGCAGGAGGCTGTTGG - Exonic
1181699362 22:24611160-24611182 TCAGGTTCCTTGGAGGCTGAGGG - Exonic
1182067615 22:27441935-27441957 TCTTCTTCCCAGGAAGCCGTGGG - Intergenic
1182407885 22:30153271-30153293 TCTAGGATCCAGGAGGCTGTGGG - Intronic
1184925399 22:47632917-47632939 TCTGTCTCCCTGCAGGCTGTGGG - Intergenic
1185023368 22:48393507-48393529 TCTGGGTGCCAGGAGCCAGTAGG - Intergenic
950031468 3:9856742-9856764 TCTGGTCTCCAGGAGTCTCTAGG - Intergenic
950116023 3:10450727-10450749 TCTGGAGCCCAGGAGGAGGTGGG + Intronic
950291232 3:11786092-11786114 TCTGGTGCCCAGGCTGGTGTGGG + Intergenic
950332858 3:12170168-12170190 TCTGGTTCCCTGGAGACTTCAGG - Intronic
952899509 3:38100153-38100175 TCTGGATCCCAGATGGCTCTTGG + Intronic
953389512 3:42526254-42526276 TGAGGTTCCCATGAGGCAGTAGG - Intronic
955103456 3:55874116-55874138 TTTGGTTTCCAGGAAGCTGAAGG - Intronic
956079141 3:65538868-65538890 TCTGGTTGACAGTAGGCAGTTGG - Intronic
956376760 3:68621082-68621104 TCAGGTTCTCAGGAGGGTTTAGG - Intergenic
956774764 3:72555840-72555862 TCTGGAGGCCAGCAGGCTGTTGG + Intergenic
956784530 3:72631374-72631396 TCTCGTTCCCGGTAGACTGTAGG - Intergenic
960042145 3:113161634-113161656 TCTGGGCCCCATGAGGCTGGGGG - Intergenic
962009685 3:131381472-131381494 TTTGGCTCCCAGGAGCCTTTAGG + Intergenic
962262883 3:133926259-133926281 CCTGGCTGCCAGGAGCCTGTGGG + Intergenic
963719253 3:148841094-148841116 TCTGGTTCCCTCGGGGATGTAGG - Intronic
966193929 3:177295416-177295438 TTTGGTTCCCAGGTAGGTGTTGG + Intergenic
969525989 4:7704366-7704388 CCTGATTCCCAGGTGGCTGGGGG - Intronic
969695515 4:8732043-8732065 ACTGTTTCCCAGAAGGCTGGGGG + Intergenic
971292711 4:25359506-25359528 TCTGATACCAAGGAGGCTGTTGG + Intronic
977793690 4:101137008-101137030 CCTGGTTCTCAAGTGGCTGTTGG - Intronic
980482425 4:133404181-133404203 TCTGGTCACCAGCAGGCTGTTGG - Intergenic
982049751 4:151489141-151489163 TCAGGTTCCCAGTGGGATGTGGG - Intronic
982165059 4:152606771-152606793 TCTGGGTCCCAGGACTCTGAAGG + Intergenic
983401185 4:167268279-167268301 TCTGGGTCACAGGATGATGTAGG + Intergenic
985579058 5:687209-687231 TCTGGTCTCCAGGAGGATGGGGG + Intronic
985599664 5:820510-820532 TCTTCTGCCCAGGAAGCTGTGGG + Intronic
985982554 5:3483092-3483114 TCGTGTGCCCAGGAGGCTGGTGG + Intergenic
986289774 5:6390465-6390487 TGAGGGTCCCATGAGGCTGTAGG - Intergenic
986543866 5:8874192-8874214 TCAGGTGTCCAGGAGGCTGCAGG - Intergenic
989696010 5:44201296-44201318 TCTGGTTCTGAGGAGGCCTTAGG - Intergenic
990213412 5:53504960-53504982 TCAGGTACTCAGGAGGCTGGAGG + Intergenic
990229409 5:53695437-53695459 TCAGCTTCTGAGGAGGCTGTAGG - Intergenic
993135009 5:83949865-83949887 TTTGTTTCCCAGGGGGCTCTGGG + Intronic
994679894 5:102873339-102873361 GCTGGTGCCCAAAAGGCTGTTGG - Intronic
997408925 5:133675420-133675442 TGTGGTGGCCAGAAGGCTGTGGG + Intergenic
997967576 5:138371342-138371364 TCAGCTACCCAGGAGGCTGAGGG + Intronic
998745742 5:145258085-145258107 TCTGCTTCTCAGGAGGCTTCAGG - Intergenic
999374719 5:151078975-151078997 TCGGGGCCCCAGGAAGCTGTGGG - Intronic
999774992 5:154804983-154805005 TCTGGTTAACAGTAGGCTTTTGG - Intronic
1001281530 5:170389530-170389552 TCTGTTTCCCACGAGACTCTGGG - Exonic
1001828302 5:174764414-174764436 TCTAGTTGCCAGGAAGCTGCTGG + Intergenic
1001895645 5:175377734-175377756 ACTGGTTACCAGGAGGCAGGAGG - Intergenic
1002295062 5:178225906-178225928 ACTGGTGCCCAGGGGGCTGTGGG - Intronic
1002457772 5:179355493-179355515 TCTTGTGCCCAGGAGGATGCAGG - Intergenic
1002469898 5:179428937-179428959 GCTGGGTCCTAGGAGGCTGCAGG + Intergenic
1003500601 6:6699880-6699902 GCTGGTTCACAGGAGGTTGGTGG + Intergenic
1003963330 6:11229475-11229497 GCTGTTTCCCAGGAGGGTGATGG - Intronic
1004156456 6:13172455-13172477 TCAGGTTACCAGGAGGCTGAAGG + Intronic
1004321298 6:14633661-14633683 TCTGGAGACCAGGAGGCTGGGGG - Intergenic
1005385928 6:25284112-25284134 TCTGGTGCCCAGCAGCCTCTGGG - Intronic
1006446684 6:34083703-34083725 CCTGGGTCCCAGGAGGCAGCTGG + Intronic
1006541499 6:34743794-34743816 CCAGGTACCCAGGAGGCTGAGGG + Intergenic
1007690252 6:43696437-43696459 TCAGTTTCCCAGAAGGCTTTGGG - Intergenic
1011300261 6:85865962-85865984 TCTGTTTCCTGGGGGGCTGTTGG + Intergenic
1011898928 6:92268116-92268138 TCTGCTTCTCAGGATTCTGTAGG + Intergenic
1014392260 6:120877255-120877277 TCTGTTTCCAAGGAGGCTGGGGG + Intergenic
1014655564 6:124099633-124099655 TGTGGTTCTCAGGAGGAGGTGGG + Intronic
1015117707 6:129667733-129667755 ACTGGTTCCCAGCAGGCTCTTGG + Intronic
1017013890 6:150084457-150084479 TCTCTTTCCCAGGAGGATGGAGG - Intergenic
1017440452 6:154460046-154460068 TCAGGGTCCCAGGAGGGGGTGGG - Intronic
1017713180 6:157187867-157187889 GATGTTTCCAAGGAGGCTGTCGG + Intronic
1018377505 6:163227186-163227208 TCTGCTTCCCAGGAGGCCTCGGG + Intronic
1018463942 6:164025249-164025271 CCTGGCTCCCAGGAGGGTGTGGG + Intergenic
1018944067 6:168333582-168333604 TCTGCTTCCGGGGAGGCTTTAGG + Intergenic
1024213316 7:47226035-47226057 TCTAGTTCTCAGGTGGCTGCAGG - Intergenic
1024722380 7:52151835-52151857 GATGCTTCCCAGCAGGCTGTGGG - Intergenic
1024866959 7:53914013-53914035 TGTGGTTACCTGGAAGCTGTGGG - Intergenic
1026575017 7:71564729-71564751 AGAGGTGCCCAGGAGGCTGTGGG - Intronic
1027755103 7:82202770-82202792 TCTGATACAGAGGAGGCTGTTGG + Intronic
1028510785 7:91624106-91624128 TCAGCTACCCAGGAGGCTGAGGG - Intergenic
1029306899 7:99626227-99626249 GCTGGTTCCCAGGATGGTGAGGG + Intronic
1030496187 7:110303859-110303881 TCTAACTCCCAGAAGGCTGTAGG - Intergenic
1031151713 7:118061445-118061467 TCTGATTCCCAGGAATCTGGTGG + Intergenic
1031905809 7:127458598-127458620 TCAGTTTCCGAGGAGGCTTTAGG - Intergenic
1031974881 7:128087286-128087308 GCTGGATCCCAGGGGGCTTTTGG + Intronic
1031987342 7:128171690-128171712 TCTGCTTCCCCAGAGGCTGCAGG + Intergenic
1032478171 7:132226349-132226371 CCTGCTCCCCAGGCGGCTGTTGG + Intronic
1033245618 7:139714411-139714433 CCTGGTGCCCAGCAGGCTGAGGG + Intronic
1033363886 7:140656872-140656894 TTTGGTTCCTGGGGGGCTGTTGG - Intronic
1034576716 7:152006119-152006141 TCTGGTTCCCTGGAGGCCCAGGG + Intronic
1035030041 7:155850903-155850925 TCTGTTTCCTACCAGGCTGTAGG - Intergenic
1035717915 8:1768024-1768046 TCTGGAACCCAGGAGGGTGGAGG - Intronic
1035966080 8:4193540-4193562 TCTGAGTCACAAGAGGCTGTGGG + Intronic
1037453606 8:19041240-19041262 TCTGGTTTACAGGAGGTAGTGGG - Intronic
1037769173 8:21789009-21789031 TCGGGCTCCCAGGCGGCTGGCGG + Intronic
1037841469 8:22248278-22248300 TGTGGGTACCAGGAGGCTGGGGG + Exonic
1039513490 8:38111015-38111037 TCTGGGACCCAGGAGGCAGAGGG - Intronic
1040291201 8:46125941-46125963 TCTGGTTCCTTGGGGGCTGTTGG - Intergenic
1040675183 8:49740722-49740744 TCTGGTGCCCAGAAGAATGTTGG - Intergenic
1044014989 8:87040163-87040185 TCTAGTTCCCAGGAGGAAGGGGG + Intronic
1044106130 8:88209479-88209501 TCTGGTCAACAGGAGGCTATTGG + Intronic
1044327149 8:90871709-90871731 TCTGGTTCATGGGATGCTGTAGG - Intronic
1048225089 8:132577481-132577503 CCTGGTTCCCAGGGAGATGTTGG - Intronic
1049349000 8:142154111-142154133 GCTGGCTCCCAAGAGGCTGGAGG - Intergenic
1049441149 8:142610340-142610362 ACTGGATTCCAAGAGGCTGTGGG - Intergenic
1050249181 9:3725831-3725853 TCTGTCTCCTAGGAGGCTTTTGG - Intergenic
1050388191 9:5111845-5111867 TCGGGAGCCCAGGAGGTTGTCGG - Intronic
1050507781 9:6365271-6365293 TTTGGGTGGCAGGAGGCTGTGGG + Intergenic
1053273446 9:36766041-36766063 TGTGGTTCCCCGGAGACTCTGGG + Intergenic
1053324270 9:37128661-37128683 GCAGTTTCCCAGGAGGCTGAAGG + Intronic
1054712281 9:68523309-68523331 ACAGCTTCCCAGGATGCTGTTGG - Intronic
1056559372 9:87716857-87716879 CCAGCTTCCCAGGAGCCTGTTGG + Intergenic
1056568764 9:87797945-87797967 CCAGCTTCCCAGGAGCCTGTTGG - Intergenic
1056778727 9:89533463-89533485 GCTGCTTCCCACGAGGCTGGTGG + Intergenic
1056954976 9:91074415-91074437 CCTGGTTCCCAGGAGCCCCTGGG - Intergenic
1057442482 9:95092173-95092195 TCTGGTTCCTTGTAAGCTGTTGG - Intergenic
1057890241 9:98864445-98864467 TCTGGTTCCCAGGACACTTCTGG - Intergenic
1058684281 9:107466479-107466501 CCTGGGTCCCAGGTGACTGTGGG - Intergenic
1059283809 9:113156049-113156071 TCTGGTTTCCAGGAGGCTACAGG + Intronic
1059325801 9:113503499-113503521 GCTGGTGCCCAGGAGGGTGAGGG + Intronic
1059470011 9:114497861-114497883 CCTCCTTCCCAGGTGGCTGTGGG - Intronic
1059619361 9:115986550-115986572 CCTTGTTCCCAGAAGGCTGGGGG + Intergenic
1060036389 9:120259640-120259662 TCAGGTTCCCAGCAGGGTGCTGG + Intergenic
1060668540 9:125448094-125448116 CCTGGTTCCCTGGAGCCTGGAGG + Intronic
1061117280 9:128622264-128622286 GCTCGTTGCCAGGAGGCTGAAGG - Intronic
1061216221 9:129223564-129223586 TCGGGTTCCTAGGTGGCTGTGGG + Intergenic
1061536381 9:131252682-131252704 TCTCCTTCCCCAGAGGCTGTGGG + Intergenic
1061797973 9:133099255-133099277 TCTGGTTTATAGCAGGCTGTGGG - Intronic
1186420323 X:9420365-9420387 CCAGGTTCCCAGGAGGCTTAAGG + Intergenic
1187472980 X:19585914-19585936 ACTGGTTTGCAGGAGGGTGTGGG - Intronic
1189056198 X:37701767-37701789 TCTGGTTCTCAGGTTACTGTTGG + Intronic
1189245695 X:39561603-39561625 GCTTGTTGCCAGCAGGCTGTTGG + Intergenic
1189742806 X:44138241-44138263 ACTGGTTGCCAGGGGGCTGAGGG + Intergenic
1189984949 X:46545463-46545485 TCACGTTCCCAGGGGGCTGTGGG - Intergenic
1192800697 X:74462199-74462221 TCTGGTTCCCAAGCGCCTTTGGG + Intronic
1192896186 X:75444951-75444973 TCAGGTTCTCAGGAGGCCTTTGG + Intronic
1193499941 X:82263088-82263110 TCTTGTTCACAGGAGGTGGTGGG + Intergenic
1202347801 Y:23953407-23953429 GTTGGATCCCAGGAAGCTGTGGG + Intergenic
1202522972 Y:25716684-25716706 GTTGGATCCCAGGAAGCTGTGGG - Intergenic