ID: 1124349967

View in Genome Browser
Species Human (GRCh38)
Location 15:28948055-28948077
Sequence TCACCTCTCTGGATGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124349967_1124349973 18 Left 1124349967 15:28948055-28948077 CCTTGCACCATCCAGAGAGGTGA 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1124349973 15:28948096-28948118 GTATAGAGTCTACTGTTTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 115
1124349967_1124349974 19 Left 1124349967 15:28948055-28948077 CCTTGCACCATCCAGAGAGGTGA 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1124349974 15:28948097-28948119 TATAGAGTCTACTGTTTTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 218
1124349967_1124349976 21 Left 1124349967 15:28948055-28948077 CCTTGCACCATCCAGAGAGGTGA 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1124349976 15:28948099-28948121 TAGAGTCTACTGTTTTCAGGGGG 0: 1
1: 0
2: 2
3: 13
4: 145
1124349967_1124349975 20 Left 1124349967 15:28948055-28948077 CCTTGCACCATCCAGAGAGGTGA 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1124349975 15:28948098-28948120 ATAGAGTCTACTGTTTTCAGGGG 0: 1
1: 0
2: 4
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124349967 Original CRISPR TCACCTCTCTGGATGGTGCA AGG (reversed) Intronic